REG3G (NM_001270040) Human Untagged Clone
CAT#: SC332905
REG3G (untagged) - Homo sapiens regenerating islet-derived 3 gamma (REG3G), transcript variant 3
"NM_001270040" in other vectors (2)
Product Images
Other products for "REG3G"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | REG3G |
Synonyms | LPPM429; PAP-1B; PAP1B; PAP IB; PAPIB; REG-III; REG III; UNQ429 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001270040, the custom clone sequence may differ by one or more nucleotides
ATGCTGCCTCCCATGGCCCTGCCCAGTGTGTCCTGGATGCTGCTTTCCTGCCTCATTCTCCTGTGTCAGG TTCAAGGTGAAGAAACCCAGAAGGAACTGCCCTCTCCACGGATCAGCTGTCCCAAAGGCTCCAAGGCCTA TGGCTCCCCCTGCTATGCCTTGTTTTTGTCACCAAAATCCTGGATGGATGCAGATGGCTCTGAGCCTGAT GGAGATGGATGGGAGTGGAGTAGCACTGATGTGATGAATTACTTTGCATGGGAGAAAAATCCCTCCACCA TCTTAAACCCTGGCCACTGTGGGAGCCTGTCAAGAAGCACAGGATTTCTGAAGTGGAAAGATTATAACTG TGATGCAAAGTTACCCTATGTCTGCAAGTTCAAGGACTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270040 |
ORF Size | 390 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001270040.1, NP_001256969.1 |
RefSeq Size | 817 |
RefSeq ORF | 390 |
Locus ID | 130120 |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes a member of the regenerating islet-derived genes (REG)3 protein family. These proteins are secreted, C-type lectins with a carbohydrate recognition domain and N-terminal signal peptide. The protein encoded by this gene is an antimicrobial lectin with activity against Gram-positive bacteria. Alternative splicing results in multiple transcript variants encoding multiple isoforms. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (3) lacks an alternate in-frame exon in the coding region compared to variant 1. It encodes isoform 2 which is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.