ANKRD46 (NM_001270379) Human Untagged Clone

CAT#: SC332915

ANKRD46 (untagged) - Homo sapiens ankyrin repeat domain 46 (ANKRD46), transcript variant 4


  "NM_001270379" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ANKRD46"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ANKRD46
Synonyms ANK-S; GENX-115279
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270379, the custom clone sequence may differ by one or more nucleotides


ATGTCGTATGTTTTTGTAAATGATTCTTCTCAGACTAACGTGCCCTTGCTGCAAGCCTGTATTGATGGGG
ACTTTAATTATTCCAAGCGGCTTTTGGAAAGTGGCTTTGACCCAAATATTCGTGACAGCAGGGGCAGAAC
AGGCCTTCACCTTGCAGCAGCTCGAGGGAATGTAGACATCTGCCAGTTACTGCATAAATTCGGTGCCGAT
CTTCTGGCCACAGATTATCAAGGAAACACAGCTCTTCACCTCTGTGGCCATGTGGATACTATCCAATTTT
TGGTTTCCAATGGACTCAAAATTGATATTTGCAATCATCAAGGTGCTACCCCTTTAGTTCTGGCAAAGCG
CAGAGGAGTAAATAAAGATGTCATCCGATTGCTGGAATCTTTGGAAGAACAGGAGGTGAAAGGATTTAAC
AGAGGAACCCACTCGAAACTGGAGACCATGCAAACAGCTGAGAGTGAAAGTGCCATGGAAAGCCATTCAC
TCCTCAATCCCAACCTGCAGCAAGGTGAAGGAGTCCTCTCCAGCTTCCGAACCACGTGGCAGGAGTTTGT
GGAGGATCTGGGCTTCTGGAGAGTATTGCTGTTGATCTTCGTCATTGCTTTGCTGTCTCTTGGCATTGCT
TATTATAGAAGGACACTGAGGCTTGGAAGCTTTGCAAGGCAAGACAGAAGCCGAATCCAGGCCATCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001270379
ORF Size 699 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001270379.1, NP_001257308.1
RefSeq Size 1741
RefSeq ORF 699
Locus ID 157567
Protein Families Transmembrane
Gene Summary This gene encodes a protein containing multiple ankyrin repeats. Ankyrin domains function in protein-protein interactions in a variety of cellular processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Transcript Variant: This variant (4) uses alternate 3' exon structure, and differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded protein (isoform 2) has a distinct C-terminus and is longer than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.