alpha Tubulin (TUBA1A) (NM_001270399) Human Untagged Clone

CAT#: SC332920

TUBA1A (untagged) - Homo sapiens tubulin, alpha 1a (TUBA1A), transcript variant 2


  "NM_001270399" in other vectors (2)

Reconstitution Protocol

USD 460.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "TUBA1A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TUBA1A
Synonyms B-ALPHA-1; LIS3; TUBA3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270399, the custom clone sequence may differ by one or more nucleotides


ATGCGTGAGTGCATCTCCATCCACGTTGGCCAGGCTGGTGTCCAGATTGGCAATGCCTGCTGGGAGCTCT
ACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCAAGTGACAAGACCATTGGGGGAGGAGATGA
TTCCTTCAACACCTTCTTCAGTGAGACGGGGGCTGGCAAGCATGTGCCCCGGGCAGTGTTTGTAGACTTG
GAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAACTTATCA
CAGGCAAAGAAGATGCTGCCAATAACTATGCCCGAGGGCACTACACCATTGGCAAGGAGATCATTGACCT
CGTGTTGGACCGAATTCGCAAGCTGGCCGACCAGTGCACGGGTCTCCAGGGCTTCTTGGTTTTCCACAGC
TTTGGTGGGGGAACTGGTTCTGGGTTCACCTCGCTGCTCATGGAACGTCTCTCAGTTGATTATGGCAAGA
AGTCCAAGCTGGAGTTCTCTATTTACCCGGCGCCCCAGGTTTCCACAGCTGTAGTTGAGCCCTACAACTC
CATCCTCACCACCCACACCACCCTGGAGCACTCTGATTGTGCCTTCATGGTAGACAATGAGGCCATCTAT
GACATCTGTCGTAGAAACCTCGATATTGAGCGTCCAACCTATACTAACCTGAATAGGTTAATAGGTCAAA
TTGTGTCCTCCATCACTGCTTCCCTGAGATTTGATGGAGCCCTGAATGTTGACCTGACAGAATTCCAGAC
CAACCTGGTGCCCTATCCCCGCATCCACTTCCCTCTGGCCACATATGCCCCTGTCATCTCTGCTGAGAAA
GCCTACCATGAACAGCTTTCTGTAGCAGAGATCACCAATGCTTGCTTTGAGCCAGCCAACCAGATGGTGA
AATGTGACCCTCGCCATGGTAAATACATGGCTTGCTGCCTGTTGTACCGTGGTGACGTGGTTCCCAAAGA
TGTCAATGCTGCCATTGCCACCATCAAGACCAAGCGTACCATCCAGTTTGTGGATTGGTGCCCCACTGGC
TTCAAGGTTGGCATCAACTACCAGCCTCCCACTGTGGTGCCTGGTGGAGACCTGGCCAAGGTACAGAGAG
CTGTGTGCATGCTGAGCAACACCACAGCCATTGCTGAGGCCTGGGCTCGCCTGGACCACAAGTTTGACCT
GATGTATGCCAAACGTGCCTTTGTTCACTGGTACGTTGGGGAGGGGATGGAGGAAGGTGAGTTTTCAGAG
GCCCGTGAGGACATGGCTGCCCTTGAGAAGGATTATGAGGAGGTTGGTGTGGATTCTGTTGAAGGAGAGG
GTGAGGAAGAAGGAGAGGAATACTAA


Restriction Sites SgfI-MluI     
ACCN NM_001270399
ORF Size 1356 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001270399.1, NP_001257328.1
RefSeq Size 2490
RefSeq ORF 1356
Locus ID 7846
Protein Families Druggable Genome
Protein Pathways Gap junction, Pathogenic Escherichia coli infection
Gene Summary Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulins. The genes encoding these microtubule constituents belong to the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes, which are highly conserved among species. This gene encodes alpha tubulin and is highly similar to the mouse and rat Tuba1 genes. Northern blot studies have shown that the gene expression is predominantly found in morphologically differentiated neurologic cells. This gene is one of three alpha-tubulin genes in a cluster on chromosome 12q. Mutations in this gene cause lissencephaly type 3 (LIS3) - a neurological condition characterized by microcephaly, intellectual disability, and early-onset epilepsy caused by defective neuronal migration. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2017]
Transcript Variant: This variant (2) contains an alternate segment at its 5' end which results in the use of a different start codon, compared to variant 1. Variants 1 and 2 encode the same protein (isoform 1) but use distinct start codons.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.