APOBEC3B (NM_001270411) Human Untagged Clone

CAT#: SC332926

APOBEC3B (untagged) - Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B (APOBEC3B), transcript variant 2


  "NM_001270411" in other vectors (2)

Reconstitution Protocol

USD 360.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "APOBEC3B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol APOBEC3B
Synonyms A3B; APOBEC1L; ARCD3; ARP4; bK150C2.2; DJ742C19.2; PHRBNL
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270411, the custom clone sequence may differ by one or more nucleotides


ATGAATCCACAGATCAGAAATCCGATGGAGCGGATGTATCGAGACACATTCTACGACAACTTTGAAAACG
AACCCATCCTCTATGGTCGGAGCTACACTTGGCTGTGCTATGAAGTGAAAATAAAGAGGGGCCGCTCAAA
TCTCCTTTGGGACACAGGGGTCTTTCGAGGCCAGGTGTATTTCAAGCCTCAGTACCACGCAGAAATGTGC
TTCCTCTCTTGGTTCTGTGGCAACCAGCTGCCTGCTTACAAGTGTTTCCAGATCACCTGGTTTGTATCCT
GGACCCCCTGCCCGGACTGTGTGGCGAAGCTGGCCGAATTCCTGTCTGAGCACCCCAATGTCACCCTGAC
CATCTCTGCCGCCCGCCTCTACTACTACTGGGAAAGAGATTACCGAAGGGCGCTCTGCAGGCTGAGTCAG
GCAGGAGCCCGCGTGAAGATCATGGACTATGAAGAATTTGCATACTGCTGGGAAAACTTTGTGTACAATG
AAGGTCAGCAATTCATGCCTTGGTACAAATTCGATGAAAATTATGCATTCCTGCACCGCACGCTAAAGGA
GATTCTCAGATACCTGATGGATCCAGACACATTCACTTTCAACTTTAATAATGACCCTTTGGTCCTTCGA
CGGCGCCAGACCTACTTGTGCTATGAGGTGGAGCGCCTGGACAATGGCACCTGGGTCCTGATGGACCAGC
ACATGGGCTTTCTATGCAACGAGTTGGACCCGGCCCAGATCTACAGGGTCACTTGGTTCATCTCCTGGAG
CCCCTGCTTCTCCTGGGGCTGTGCCGGGGAAGTGCGTGCGTTCCTTCAGGAGAACACACACGTGAGACTG
CGCATCTTCGCTGCCCGCATCTATGATTACGACCCCCTATATAAGGAGGCGCTGCAAATGCTGCGGGATG
CTGGGGCCCAAGTCTCCATCATGACCTACGATGAGTTTGAGTACTGCTGGGACACCTTTGTGTACCGCCA
GGGATGTCCCTTCCAGCCCTGGGATGGACTAGAGGAGCACAGCCAAGCCCTGAGTGGGAGGCTGCGGGCC
ATTCTCCAGAATCAGGGAAACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001270411
ORF Size 1074 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001270411.1, NP_001257340.1
RefSeq Size 1485
RefSeq ORF 1074
Locus ID 9582
Gene Summary This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. A hybrid gene results from the deletion of approximately 29.5 kb of sequence between this gene, APOBEC3B, and the adjacent gene APOBEC3A. The breakpoints of the deletion are within the two genes, so the deletion allele is predicted to have the promoter and coding region of APOBEC3A, but the 3' UTR of APOBEC3B. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (2) uses an alternate in-frame splice site at the 5' end of a coding exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.