KIR5.1 (KCNJ16) (NM_001270422) Human Untagged Clone

CAT#: SC332929

KCNJ16 (untagged) - Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 16 (KCNJ16), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KCNJ16
• Synonyms: BIR9; KIR5.1
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270422, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCTATTACGGCAGCAGCTATCATATTATCAATGCGGACGCAAAATACCCAGGCTACCCGCCAGAGC
  ACATTATAGCTGAGAAGAGAAGAGCAAGAAGACGATTACTTCACAAAGATGGCAGCTGTAATGTCTACTT
  CAAGCACATTTTTGGAGAATGGGGAAGCTATGTGGTTGACATCTTCACCACTCTTGTGGACACCAAGTGG
  CGCCATATGTTTGTGATATTTTCTTTATCTTATATTCTCTCGTGGTTGATATTTGGCTCTGTCTTTTGGC
  TCATAGCCTTTCATCATGGCGATCTATTAAATGATCCAGACATCACACCTTGTGTTGACAACGTCCATTC
  TTTCACAGGGGCCTTTTTGTTCTCCCTAGAGACCCAAACCACCATAGGATATGGTTATCGCTGTGTTACT
  GAAGAATGTTCTGTGGCCGTGCTCATGGTGATCCTCCAGTCCATCTTAAGTTGCATCATAAATACCTTTA
  TCATTGGAGCTGCCTTGGCCAAAATGGCAACTGCTCGAAAGAGAGCCCAAACCATTCGTTTCAGCTACTT
  TGCACTTATAGGTATGAGAGATGGGAAGCTTTGCCTCATGTGGCGCATTGGTGATTTTCGGCCAAACCAC
  GTGGTAGAAGGAACAGTTAGAGCCCAACTTCTCCGCTATACAGAAGACAGTGAAGGGAGGATGACGATGG
  CATTTAAAGACCTCAAATTAGTCAACGACCAAATCATCCTGGTCACCCCGGTAACTATTGTCCATGAAAT
  TGACCATGAGAGCCCTCTGTATGCCCTTGACCGCAAAGCAGTAGCCAAAGATAACTTTGAGATTTTGGTG
  ACATTTATCTATACTGGTGATTCCACTGGAACATCTCACCAATCTAGAAGCTCCTATGTTCCCCGAGAAA
  TTCTCTGGGGCCATAGGTTTAATGATGTCTTGGAAGTTAAGAGGAAGTATTACAAAGTGAACTGCTTACA
  GTTTGAAGGAAGTGTGGAAGTATATGCCCCCTTTTGCAGTGCCAAGCAATTGGACTGGAAAGACCAGCAG
  CTCCACATAGAAAAAGCACCACCAGTTCGAGAATCCTGCACGTCGGACACCAAGGCGAGACGAAGGTCAT
  TTAGTGCAGTTGCCATTGTCAGCAGCTGTGAAAACCCTGAGGAGACCACCACTTCCGCCACACATGAATA
  TAGGGAAACACCTTATCAGAAAGCTCTCCTGACTTTAAACAGAATCTCTGTAGAATCCCAAATGTAG
  
  
• Restriction Sites: EcoRI-KpnI
• ACCN: NM_001270422
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001270422.1, NP_001257351.1
• RefSeq Size: 4209 bp
• RefSeq ORF: 1257 bp
• Locus ID: 3773
• Cytogenetics: 17q24.3
• Protein Families: Druggable Genome, Ion Channels: Potassium, Transmembrane
• Gene Summary: 'Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which tends to allow potassium to flow into rather than out of a cell, can form heterodimers with two other inward-rectifier type potassium channels. It may function in fluid and pH balance regulation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2014]'
  Transcript Variant: This variant (4) differs in the 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to variant a. Variants 4, 7 and 8 all encode isoform b.