p16 ARC (ARPC5) (NM_001270439) Human Untagged Clone

CAT#: SC332932

ARPC5 (untagged) - Homo sapiens actin related protein 2/3 complex, subunit 5, 16kDa (ARPC5), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ARPC5
• Synonyms: ARC16; dJ127C7.3; p16-Arc
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270439, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCGAAGAACACAGTGTCGTCGGCCCGCTTCCGGAAGGTGGACGTGGATGAATATGACGAGAACAAGT
  TCGTGGACGAAGAAGATGGGGGCGACGGCCAGGCCGGGCCCGACGAGGGCGAGGTGGACTCCTGCCTGCG
  GCATTCCATCACAGGAAACATGACAGCTGCCCTACAGGCAGCTCTGAAGAACCCCCCTATCAACACCAAG
  AGTCAGGCAGTGAAGGACCGGGCAGGCAGCATTGTCTTGAAGGTGCTCATCTCTTTTAAAGCTAATGATA
  TAGAAAAGGCAGTTCAATCTCTGGACAAGAATGGTGTGGATCTCCTAATGAAGTATATTTATAAAGGATT
  TGAGAGCCCGTCTGACAATAGCAGTGCTATGTTACTGCAATGGCATGAAAAGGCACTTGCTGCTGGAGGA
  GTAGGGTCCATTGTTCGTGTCTTGACTGCAAGAAAAACTGTGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270439
• ORF Size: 465 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001270439.1, NP_001257368.1
• RefSeq Size: 2094
• RefSeq ORF: 465
• Locus ID: 10092
• Protein Pathways: Fc gamma R-mediated phagocytosis, Pathogenic Escherichia coli infection, Regulation of actin cytoskeleton
• Gene Summary: This gene encodes one of seven subunits of the human Arp2/3 protein complex. The Arp2/3 protein complex has been implicated in the control of actin polymerization in cells and has been conserved through evolution. The exact role of the protein encoded by this gene, the p16 subunit, has yet to be determined. Alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site compared to variant 1. The resulting protein (isoform 2) is longer compared to isoform 1.