WWP2 (NM_001270455) Human Untagged Clone

CAT#: SC332946

WWP2 (untagged) - Homo sapiens WW domain containing E3 ubiquitin protein ligase 2 (WWP2), transcript variant 6


  "NM_001270455" in other vectors (2)

Reconstitution Protocol

USD 340.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "WWP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol WWP2
Synonyms AIP2; WWp2-like
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270455, the custom clone sequence may differ by one or more nucleotides


ATGGCATCTGCCAGCTCTAGCCGGGCAGGAGTGGCCCTGCCTTTTGAGAAGTCTCAGCTCACTTTGAAAG
TGGTGTCCGCAAAGCCCAAGGTGCATAATCGTCAACCTCGAATTAACTCCTACGTGGAGGTGGCGGTGGA
TGGACTCCCCAGTGAGACCAAGAAGACTGGGAAGCGCATTGGGAGCTCTGAGCTTCTCTGGAATGAGATC
ATCATTTTGAATGTCACGGCACAGAGTCATTTAGATTTAAAGGTCTGGAGCTGCCATACCTTGAGAAATG
AACTGCTAGGCACCGCATCTGTCAACCTCTCCAACGTCTTGAAGAACAATGGGGGCAAAATGGAGAACAT
GCAGCTGACCCTGAACCTGCAGACGGAGAACAAAGGCAGCGTTGTCTCAGGCGGAGAGCTGACAATTTTC
CTGGACGGGCCAACTGTTGATCTGGGAAATGTGCCTAATGGCAGTGCCCTGACAGATGGATCACAGCTGC
CTTCGAGAGACTCCAGTGGAACAGCAGTAGCTCCAGAGAACCGGCACCAGCCCCCCAGCACAAACTGCTT
TGGTGGAAGATCCCGGACGCACAGACATTCGGGTGCTTCAGCCAGAACAACCCCAGCAACCGGCGAGCAA
AGCCCCGGTGCTCGGAGCCGGCACCGCCAGCCCGTCAAGAACTCAGGCCACAGTGGCTTGGCCAATGGCA
CAGTGAATGATGAACCCACAACAGCCACTGATCCCGAAGAACCTTCCGTTGTTGGTGTGACGTCCCCACC
TGCTGCACCCTTGAGTGTGACCCCGAATCCCAACACGACTTCTCTCCCTGCCCCAGCCACACCGGCTGAA
GGAGAGGAACCCAGCACTTCGGGTACACAGCAGCTCCCAGCGGCTGCCCAGGCCCCCGACGCTCTGCCTG
CTGGATGGGAACAGCGAGAGCTGCCCAACGGACGTGTCTATTATGTTGACCACAATACCAAGACCACCAC
CTGGGAGCGGCCCCTTCCTCCAGGGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001270455
ORF Size 1008 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001270455.1, NP_001257384.1
RefSeq Size 2682
RefSeq ORF 1008
Locus ID 11060
Protein Families Druggable Genome
Protein Pathways Ubiquitin mediated proteolysis
Gene Summary This gene encodes a member of the Nedd4 family of E3 ligases, which play an important role in protein ubiquitination. The encoded protein contains four WW domains and may play a role in multiple processes including chondrogenesis and the regulation of oncogenic signaling pathways via interactions with Smad proteins and the tumor suppressor PTEN. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 10. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (6) differs in the 3' UTR, compared to variant 1. The encoded isoform (WWP2-N) has a shorter C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.