SOCS2 (NM_001270467) Human Untagged Clone

CAT#: SC332948

SOCS2 (untagged) - Homo sapiens suppressor of cytokine signaling 2 (SOCS2), transcript variant 2


  "NM_001270467" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SOCS2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SOCS2
Synonyms CIS2; Cish2; SOCS-2; SSI-2; SSI2; STATI2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270467, the custom clone sequence may differ by one or more nucleotides


ATGACCCTGCGGTGCCTTGAGCCCTCCGGGAATGGCGGGGAAGGGACGCGGAGCCAGTGGGGGACCGCGG
GGTCGGCGGAGGAGCCATCCCCGCAGGCGGCGCGTCTGGCGAAGGCCCTGCGGGAGCTCGGTCAGACAGG
ATGGTACTGGGGAAGTATGACTGTTAATGAAGCCAAAGAGAAATTAAAAGAGGCACCAGAAGGAACTTTC
TTGATTAGAGATAGCTCGCATTCAGACTACCTACTAACAATATCTGTTAAAACATCAGCTGGACCAACTA
ATCTTCGAATCGAATACCAAGACGGAAAATTCAGATTGGACTCTATCATATGTGTCAAATCCAAGCTTAA
ACAATTTGACAGTGTGGTTCATCTGATCGACTACTATGTTCAGATGTGCAAGGATAAGCGGACAGGTCCA
GAAGCCCCCCGGAACGGCACTGTTCACCTTTATCTGACCAAACCGCTCTACACGTCAGCACCATCTCTGC
AGCATCTCTGTAGGCTCACCATTAACAAATGTACCGGTGCCATCTGGGGACTGCCTTTACCAACAAGACT
AAAAGATTACTTGGAAGAATATAAATTCCAGGTATAA


Restriction Sites SgfI-MluI     
ACCN NM_001270467
ORF Size 597 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001270467.1, NP_001257396.1
RefSeq Size 2649
RefSeq ORF 597
Locus ID 8835
Protein Families Druggable Genome
Protein Pathways Insulin signaling pathway, Jak-STAT signaling pathway, Type II diabetes mellitus
Gene Summary This gene encodes a member of the suppressor of cytokine signaling (SOCS) family. SOCS family members are cytokine-inducible negative regulators of cytokine receptor signaling via the Janus kinase/signal transducer and activation of transcription pathway (the JAK/STAT pathway). SOCS family proteins interact with major molecules of signaling complexes to block further signal transduction, in part, by proteasomal depletion of receptors or signal-transducing proteins via ubiquitination. The expression of this gene can be induced by a subset of cytokines, including erythropoietin, GM-CSF, IL10, interferon (IFN)-gamma and by cytokine receptors such as growth horomone receptor. The protein encoded by this gene interacts with the cytoplasmic domain of insulin-like growth factor-1 receptor (IGF1R) and is thought to be involved in the regulation of IGF1R mediated cell signaling. This gene has pseudogenes on chromosomes 20 and 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 5. Variants 1-6 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.