SOCS2 (NM_001270471) Human Untagged Clone
CAT#: SC332952
SOCS2 (untagged) - Homo sapiens suppressor of cytokine signaling 2 (SOCS2), transcript variant 6
"NM_001270471" in other vectors (2)
Product Images
Other products for "SOCS2"
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | SOCS2 |
| Synonyms | CIS2; Cish2; SOCS-2; SSI-2; SSI2; STATI2 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001270471, the custom clone sequence may differ by one or more nucleotides
ATGACCCTGCGGTGCCTTGAGCCCTCCGGGAATGGCGGGGAAGGGACGCGGAGCCAGTGGGGGACCGCGG GGTCGGCGGAGGAGCCATCCCCGCAGGCGGCGCGTCTGGCGAAGGCCCTGCGGGAGCTCGGTCAGACAGG ATGGTACTGGGGAAGTATGACTGTTAATGAAGCCAAAGAGAAATTAAAAGAGGCACCAGAAGGAACTTTC TTGATTAGAGATAGCTCGCATTCAGACTACCTACTAACAATATCTGTTAAAACATCAGCTGGACCAACTA ATCTTCGAATCGAATACCAAGACGGAAAATTCAGATTGGACTCTATCATATGTGTCAAATCCAAGCTTAA ACAATTTGACAGTGTGGTTCATCTGATCGACTACTATGTTCAGATGTGCAAGGATAAGCGGACAGGTCCA GAAGCCCCCCGGAACGGCACTGTTCACCTTTATCTGACCAAACCGCTCTACACGTCAGCACCATCTCTGC AGCATCTCTGTAGGCTCACCATTAACAAATGTACCGGTGCCATCTGGGGACTGCCTTTACCAACAAGACT AAAAGATTACTTGGAAGAATATAAATTCCAGGTATAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001270471 |
| ORF Size | 597 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Reference Data | |
| RefSeq | NM_001270471.1, NP_001257400.1 |
| RefSeq Size | 2541 |
| RefSeq ORF | 597 |
| Locus ID | 8835 |
| Protein Families | Druggable Genome |
| Protein Pathways | Insulin signaling pathway, Jak-STAT signaling pathway, Type II diabetes mellitus |
| Gene Summary | This gene encodes a member of the suppressor of cytokine signaling (SOCS) family. SOCS family members are cytokine-inducible negative regulators of cytokine receptor signaling via the Janus kinase/signal transducer and activation of transcription pathway (the JAK/STAT pathway). SOCS family proteins interact with major molecules of signaling complexes to block further signal transduction, in part, by proteasomal depletion of receptors or signal-transducing proteins via ubiquitination. The expression of this gene can be induced by a subset of cytokines, including erythropoietin, GM-CSF, IL10, interferon (IFN)-gamma and by cytokine receptors such as growth horomone receptor. The protein encoded by this gene interacts with the cytoplasmic domain of insulin-like growth factor-1 receptor (IGF1R) and is thought to be involved in the regulation of IGF1R mediated cell signaling. This gene has pseudogenes on chromosomes 20 and 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (6) differs in the 5' UTR, compared to variant 5. Variants 1-6 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Germany
Japan
United Kingdom
China