OTX2 (NM_001270524) Human Untagged Clone
CAT#: SC332967
OTX2 (untagged) - Homo sapiens orthodenticle homeobox 2 (OTX2), transcript variant 4
"NM_001270524" in other vectors (2)
Product Images
Other products for "OTX2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | OTX2 |
Synonyms | CPHD6; MCOPS5 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001270524, the custom clone sequence may differ by one or more nucleotides
ATGATGTCTTATCTTAAGCAACCGCCTTACGCAGTCAATGGGCTGAGTCTGACCACTTCGGGTATGGACT TGCTGCACCCCTCCGTGGGCTACCCGGCCACCCCCCGGAAACAGCGCCGGGAGAGGACGACGTTCACTCG GGCGCAGCTAGATGTGCTGGAAGCACTGTTTGCCAAGACCCGGTACCCAGACATCTTCATGCGAGAGGAG GTGGCACTGAAAATCAACTTGCCCGAGTCGAGGGTGCAGGTATGGTTTAAGAATCGAAGAGCTAAGTGCC GCCAACAACAGCAACAACAGCAGAATGGAGGTCAAAACAAAGTGAGACCTGCCAAAAAGAAGACATCTCC AGCTCGGGAAGTGAGTTCAGAGAGTGGAACAAGTGGCCAATTCACTCCCCCCTCTAGCACCTCAGTCCCG ACCATTGCCAGCAGCAGTGCTCCTGTGTCTATCTGGAGCCCAGCTTCCATCTCCCCACTGTCAGATCCCT TGTCCACCTCCTCTTCCTGCATGCAGAGGTCCTATCCCATGACCTATACTCAGGCTTCAGGTTATAGTCA AGGATATGCTGGCTCAACTTCCTACTTTGGGGGCATGGACTGTGGATCATATTTGACCCCTATGCATCAC CAGCTTCCCGGACCAGGGGCCACACTCAGTCCCATGGGTACCAATGCAGTCACCAGCCATCTCAATCAGT CCCCAGCTTCTCTTTCCACCCAGGGATATGGAGCTTCAAGCTTGGGTTTTAACTCAACCACTGATTGCTT GGATTATAAGGACCAAACTGCCTCCTGGAAGCTTAACTTCAATGCTGACTGCTTGGATTATAAAGATCAG ACATCCTCGTGGAAATTCCAGGTTTTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270524 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270524.1, NP_001257453.1 |
RefSeq Size | 2348 bp |
RefSeq ORF | 870 bp |
Locus ID | 5015 |
Cytogenetics | 14q22.3 |
Protein Families | Embryonic stem cells, Induced pluripotent stem cells, Stem cell - Pluripotency, Transcription Factors |
Gene Summary | 'This gene encodes a member of the bicoid subfamily of homeodomain-containing transcription factors. The encoded protein acts as a transcription factor and plays a role in brain, craniofacial, and sensory organ development. The encoded protein also influences the proliferation and differentiation of dopaminergic neuronal progenitor cells during mitosis. Mutations in this gene cause syndromic microphthalmia 5 (MCOPS5) and combined pituitary hormone deficiency 6 (CPHD6). This gene is also suspected of having an oncogenic role in medulloblastoma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Pseudogenes of this gene are known to exist on chromosomes two and nine. [provided by RefSeq, Jul 2012]' Transcript Variant: This variant (4) differs in the 5' UTR and lacks an in-frame segment of the coding region, compared to variant 1, and, compared to isoform a, encodes a shorter isoform (b). Variants 2-4 encode the same protein (isoform b). |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.