Midkine (MDK) (NM_001270550) Human Untagged Clone

CAT#: SC332975

MDK (untagged) - Homo sapiens midkine (neurite growth-promoting factor 2) (MDK), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MDK
• Synonyms: ARAP; MK; NEGF2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270550, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGCACCGAGGCTTCCTCCTCCTCACCCTCCTCGCCCTGCTGGCGCTCACCTCCGCGGTCGCCAAAA
  AGAAAGATAAGGTGAAGAAGGGCGGCCCGGGGAGCGAGTGCGCTGAGTGGGCCTGGGGGCCCTGCACCCC
  CAGCAGCAAGGATTGCGGCGTGGGTTTCCGCGAGGGCACCTGCGGGGCCCAGACCCAGCGCATCCGGTGC
  AGGGTGCCCTGCAACTGGAAGAAGGAGTTTGGAGCCGACTGCAAGTACAAGTTTGAGAACTGGGGTGCGT
  GTGATGGGGGCACAGGCACCAAAGTCCGCCAAGGCACCCTGAAGAAGGCGCGCTACAATGCTCAGTGCCA
  GGAGACCATCCGCGTCACCAAGCCCTGCACCCCCAAGACCAAAGCAAAGGCCAAAGCCAAGAAAGGGAAG
  GGAAAGGACTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270550
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001270550.1, NP_001257479.1
• RefSeq Size: 1194 bp
• RefSeq ORF: 432 bp
• Locus ID: 4192
• Cytogenetics: 11p11.2
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Gene Summary: 'This gene encodes a member of a small family of secreted growth factors that binds heparin and responds to retinoic acid. The encoded protein promotes cell growth, migration, and angiogenesis, in particular during tumorigenesis. This gene has been targeted as a therapeutic for a variety of different disorders. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Jul 2012]'
  Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3, 4, and 5 encode the same isoform (a).