mtTFA (TFAM) (NM_001270782) Human Untagged Clone
CAT#: SC333002
TFAM (untagged) - Homo sapiens transcription factor A, mitochondrial (TFAM), transcript variant 2
"NM_001270782" in other vectors (2)
Product Images
Other products for "TFAM"
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | TFAM |
| Synonyms | MTDPS15; MTTF1; MTTFA; TCF6; TCF6L1; TCF6L2; TCF6L3 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001270782, the custom clone sequence may differ by one or more nucleotides
ATGGCGTTTCTCCGAAGCATGTGGGGCGTGCTGAGTGCCCTGGGAAGGTCTGGAGCAGAGCTGTGCACCG GCTGTGGAAGTCGACTGCGCTCCCCCTTCAGTTTTGTGTATTTACCGAGGTGGTTTTCATCTGTCTTGGC AAGTTGTCCAAAGAAACCTGTAAGTTCTTACCTTCGATTTTCTAAAGAACAACTACCCATATTTAAAGCT CAGAACCCAGATGCAAAAACTACAGAACTAATTAGAAGAATTGCCCAGCGTTGGAGGGAACTTCCTGATT CAAAGAAAAAAATATATCAAGATGCTTATAGGGCGGAGTGGCAGGTATATAAAGAAGAGATAAGCAGATT TAAAGAACAGCTAACTCCAAGTCAGATTATGTCTTTGGAAAAAGAAATCATGGACAAACATTTAAAAAGG AAAGCTATGACAAAAAAAAAAGAAAAGCTGAAGACTGTAAAGGAAAACTGGAAAAATCTGTCTGACTCTG AAAAGGAATTATATATTCAGCATGCTAAAGAGGACGAAACTCGTTATCATAATGAAATGAAGTCTTGGGA AGAACAAATGATTGAAGTTGGACGAAAGGATCTTCTACGTCGCACAATAAAGAAACAACGAAAATATGGT GCTGAGGAGTGTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001270782 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001270782.1, NP_001257711.1 |
| RefSeq Size | 5223 bp |
| RefSeq ORF | 645 bp |
| Locus ID | 7019 |
| Cytogenetics | 10q21.1 |
| Protein Families | Druggable Genome, Transcription Factors |
| Protein Pathways | Huntington's disease |
| Gene Summary | 'This gene encodes a key mitochondrial transcription factor containing two high mobility group motifs. The encoded protein also functions in mitochondrial DNA replication and repair. Sequence polymorphisms in this gene are associated with Alzheimer's and Parkinson's diseases. There are pseudogenes for this gene on chromosomes 6, 7, and 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]' Transcript Variant: This variant (2, also known as tr6 or delta 5TFam) lacks an exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Germany
Japan
United Kingdom
China