RANK (TNFRSF11A) (NM_001270949) Human Untagged Clone
CAT#: SC333012
TNFRSF11A (untagged) - Homo sapiens tumor necrosis factor receptor superfamily, member 11a, NFKB activator (TNFRSF11A), transcript variant 2
"NM_001270949" in other vectors (2)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | TNFRSF11A |
| Synonyms | CD265; FEO; LOH18CR1; ODFR; OFE; OPTB7; OSTS; PDB2; RANK; TRANCER |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001270949, the custom clone sequence may differ by one or more nucleotides
ATGGCCCCGCGCGCCCGGCGGCGCCGCCCGCTGTTCGCGCTGCTGCTGCTCTGCGCGCTGCTCGCCCGGC TGCAGGTGGCTTTGCAGATCGCTCCTCCATGTACCAGTGAGAAGCATTATGAGCATCTGGGACGGTGCTG TAACAAATGTGAACCAGGAAAGTACATGTCTTCTAAATGCACTACTACCTCTGACAGTGTATGTCTGCCC TGTGGCCCGGATGAATACTTGGATAGCTGGAATGAAGAAGATAAATGCTTGCTGCATAAAGTTTGTGATA CAGGCAAGGCCCTGGTGGCCGTGGTCGCCGGCAACAGCACGACCCCCCGGCGCTGCGCGTGCACGGCTGG GTACCACTGGAGCCAGGACTGCGAGTGCTGCCGCCGCAACACCGAGTGCGCGCCGGGCCTGGGCGCCCAG CACCCGTTGCAGCTCAACAAGGACACAGTGTGCAAACCTTGCCTTGCAGGCTACTTCTCTGATGCCTTTT CCTCCACGGACAAATGCAGACCCTGGACCAACTGTACCTTCCTTGGAAAGAGAGTAGAACATCATGGGAC AGAGAAATCCGATGCGGTTTGCAGTTCTTCTCTGCCAGCTAGAAAACCACCAAATGAACCCCATGTTTAC TTGCCCGGTTTAATAATTCTGCTTCTCTTCGCGTCTGTGGCCCTGGTGGCTGCCATCATCTTTGGCGTTT GCTATAGGAAAAAAGGGAAAGCACTCACAGCTAATTTGTGGCACTGGATCAATGAGGCTTGTGGCCGCCT AAGTGGAGATAAGGAAATGTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001270949 |
| ORF Size | 792 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Reference Data | |
| RefSeq | NM_001270949.1, NP_001257878.1 |
| RefSeq Size | 3809 |
| RefSeq ORF | 792 |
| Locus ID | 8792 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Cytokine-cytokine receptor interaction |
| Gene Summary | The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptors can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. This receptor and its ligand are important regulators of the interaction between T cells and dendritic cells. This receptor is also an essential mediator for osteoclast and lymph node development. Mutations at this locus have been associated with familial expansile osteolysis, autosomal recessive osteopetrosis, and Paget disease of bone. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (2, also known as delta9) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC233585 | TNFRSF11A (Myc-DDK tagged) - Homo sapiens tumor necrosis factor receptor superfamily, member 11a, NFKB activator (TNFRSF11A), transcript variant 2 |
USD 420.00 |
|
| RG233585 | TNFRSF11A (GFP-tagged) - Homo sapiens tumor necrosis factor receptor superfamily, member 11a, NFKB activator (TNFRSF11A), transcript variant 2 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China