KCNMA1 (NM_001271520) Human Untagged Clone

CAT#: SC333061

KCNMA1 (untagged) - Homo sapiens potassium large conductance calcium-activated channel, subfamily M, alpha member 1 (KCNMA1), transcript variant 7


  "NM_001271520" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNMA1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCNMA1
Synonyms bA205K10.1; BKTM; CADEDS; hSlo; KCa1.1; MaxiK; mSLO1; PNKD3; SAKCA; SLO; SLO-ALPHA; SLO1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001271520, the custom clone sequence may differ by one or more nucleotides


ATGGCAAATGGTGGCGGCGGCGGCGGCGGCAGCAGCGGCGGCGGCGGCGGCGGCGGAGGCAGCAGTCTTA
GAATGAGTAGCAATATCCACGCGAACCATCTCAGCCTAGACGCGTCCTCCTCCTCCTCCTCCTCCTCTTC
CTCTTCTTCTTCTTCCTCCTCCTCTTCCTCCTCGTCCTCGGTCCACGAGCCCAAGATGGATGCGCTCATC
ATCCCGGTGACCATGGAGGTGCCGTGCGACAGCCGGGGCCAACGCATGTGGTGGGCTTTCCTGGCCTCCT
CCATGGTGACTTTCTTCGGGGGCCTCTTCATCATCTTGCTCTGGCGGACGCTCAAGTACCTGTGGACCGT
GTGCTGCCACTGCGGGGGCAAGACGAAGGGTTGTTGGCGGCTGCGGCTGGGGCCGGGGTCGGGGACTCAC
AGGCTCGGGTGCCGTGGTGCGGGGTGGGGACAGCCAACTCAGCGGGGACGGAGGAAGCTGGGGGCAGCTG
GGTGCGTGTTTTGCACCGCTCACCTGCCGGGGCTCGGCTCCTGGCGGTGGGCGAGAGGGAGCACATCCGC
CCATACTTTAGGAACCTGTTGGGGAGATGAGTTCGTGGGGTCAGAAAGAAGGGAAAAATCCTTTGGGCAA
GGGAGAGAATAA


Restriction Sites SgfI-RsrII     
ACCN NM_001271520
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271520.1, NP_001258449.1
RefSeq Size 1385 bp
RefSeq ORF 642 bp
Locus ID 3778
Cytogenetics 10q22.3
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Protein Pathways Vascular smooth muscle contraction
Gene Summary 'MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (7) is a two-exon transcript with a distinct 3'UTR compared to variant 1. The predicted protein (short1) has a distinct C-terminus and is significantly shorter than isoform a. It is unknown if this protein is stable or has any function.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.