JPH3 (NM_001271604) Human Untagged Clone

CAT#: SC333067

JPH3 (untagged) - Homo sapiens junctophilin 3 (JPH3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: JPH3
• Synonyms: CAGL237; HDL2; JP-3; JP3; TNRC22
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271604, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCAGTGGGGGCAGGTTTAATTTTGACGACGGAGGGTCCTACTGTGGAGGCTGGGAGGACGGCAAGG
  CGCACGGCCATGGCGTCTGCACCGGCCCCAAGGGCCAAGGCGAATACACCGGCTCGTGGAGCCACGGCTT
  CGAGGTGCTGGGCGTCTACACCTGGCCCAGCGGCAACACGTACCAGGGCACCTGGGCGCAGGGCAAGCGC
  CACGGCATCGGCCTGGAGAGCAAGGGGAAGTGGGTGTACAAGGGCGAGTGGACGCACGGATTCAAGGGGC
  GCTACGGGGTGCGGGAGTGCGCGGGCAACGGGGCCAAATACGAAGGGACCTGGAGCAACGGGCTGCAGGA
  CGGCTACGGGACCGAGACCTACTCGGACGGAGATGCCACCGCATTCGGGGCAGAGCCGGGGCCGGAAGCC
  AGGGAGCTGCCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGTAAGATGGTTTCTGTGCA
  GGGAACCTTGGCCGGCTCTGCAGCTGCCCGCCTGCCTGGACTCTCCGATATCCACTCCTCAGTGCACCTG
  A
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271604
• ORF Size: 561 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271604.2, NP_001258533.1
• RefSeq Size: 1087
• RefSeq ORF: 561
• Locus ID: 57338
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. CAG/CTG repeat expansion from normally 6-28 repeats to 40-59 repeats in the 3' UTR of this gene have been associated with Huntington disease-like 2 (HDL2). This gene is a member of the junctophilin gene family. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2016]
  Transcript Variant: This variant (2) lacks several exons and includes an alternate 3' terminal exon compared to variant 1. The latter results in a frame-shift and a much shorter isoform (2) with a distinct C-terminus containing a 13 aa polyalanine stretch compared to isoform 1. This variant is described in PMID:11694876.