TINP1 (NSA2) (NM_001271665) Human Untagged Clone

CAT#: SC333079

NSA2 (untagged) - Homo sapiens NSA2 ribosome biogenesis homolog (S. cerevisiae) (NSA2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NSA2
• Synonyms: CDK105; HCL-G1; HCLG1; HUSSY-29; HUSSY29; TINP1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271665, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCACAGAATGAATATATTGAATTACACCGTAAACGCTATGGATACCGTTTGGATTACCATGAGAAAA
  AGAGAAAGAAGGAAAGTCGAGAGGCTCATGAACGTTCAAAGAAGGCAAAGAAAATGATTGGTCTGAAGGC
  TAAGCTTTACCATAAACAGCGTCATGCTGAGAAAATACAAATGAAAAAGACTATCAAGATGCATGAAAAG
  AGAAACACCAAACAAAAGAATGATGAAAAGACACCACAGGGAGCAGTACCTGCCTATCTGCTGGACAGAG
  AGGGACAATCTCGAGCTAAAGTACTTTCCAATATGATTAAACAGAAAAGAAAAGAGAAGGCGGGAAAATG
  GGAAGTCCCTCTGCCTAAAGTACGTGCCCAGGGAGAAACAGAAGTATTAAAAGTTATTCGAACAGGAAAG
  AGAAAGAAGAAGGCATGGAAGAGAATGGTTACTAAAGTGTGCTTTGTTGGAGATGGCTTTACAAGAAAAC
  CACCTAAATATGAAAGATTCATCAGGCCAATGGAAAATATGCCCAGGTTACCAACAATCCTGAAAATGAT
  GGATGTATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271665
• ORF Size: 570 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271665.1, NP_001258594.1
• RefSeq Size: 1208
• RefSeq ORF: 570
• Locus ID: 10412
• Gene Summary: This gene encodes a nucleolar protein involved in cell cycle regulation and proliferation. This gene was identified based on sequence similarity to a highly conserved Saccharomyces cerevisiae gene encoding a pre-ribosomal protein, which is involved in large ribosomal subunit biogenesis. The encoded protein is found at elevated levels in diabetic nephropathy. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified. [provided by RefSeq, Nov 2012]
  Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1.