SPINK2 (NM_001271718) Human Untagged Clone

CAT#: SC333092

SPINK2 (untagged) - Homo sapiens serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) (SPINK2), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SPINK2
• Synonyms: HUSI-II; SPGF29
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271718, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGCTGTCGGTGCTGCGCTTGGCGCTGCTGCTCCTGGCAGTTACCTTCGCAGGTAGCGCTCGGAGCG
  GTCCTGGCGAGCGGGGACCTCCGGAGAAAAGCGGGTTTGGGAGTCAGACCGGCGGCGGACCCTGCCCTGC
  TCCGGGCGGCCTCGGCGACGGTACCCGCGCGCCCGTTACTGGCGGTTCCCCAGAGGACCTGCCAGCCTCT
  CTGATCCCTCAATTTGGTCTGTTTTCAAAATATAGAACGCCAAACTGCTCTCAGTATAGATTACCAGGAT
  GTCCCAGACACTTTAACCCTGTGTGTGGCAGTGACATGTCCACTTATGCCAATGAATGTACTCTGTGCAT
  GAAAATCAGGGAAGGTGGTCATAATATTAAAATCATTCGAAATGGACCCTGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271718
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001271718.1, NP_001258647.1
• RefSeq Size: 786 bp
• RefSeq ORF: 405 bp
• Locus ID: 6691
• Cytogenetics: 4q12
• Protein Families: Secreted Protein, Transmembrane
• Gene Summary: 'This gene encodes a member of the family of serine protease inhibitors of the Kazal type (SPINK). The encoded protein acts as a trypsin and acrosin inhibitor in the genital tract and is localized in the spermatozoa. The protein has been associated with the progression of lymphomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]'
  Transcript Variant: This variant (1) represents the longest transcript and encodes isoform 1.