Casein Kinase 1 alpha (CSNK1A1) (NM_001271742) Human Untagged Clone

CAT#: SC333099

CSNK1A1 (untagged) - Homo sapiens casein kinase 1, alpha 1 (CSNK1A1), transcript variant 4


  "NM_001271742" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CSNK1A1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CSNK1A1
Synonyms CK1; CK1a; CKIa; HEL-S-77p; HLCDGP1; PRO2975
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001271742, the custom clone sequence may differ by one or more nucleotides


ATGGATCTTCTGGGACCTAGCCTCGAAGACCTCTTCAATTTCTGTTCAAGAAGGTTCACAATGAAAACTG
TACTTATGTTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGA
CATTAAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTGTTTAGAATCTCCAGTGGGG
AAGAGGAAAAGAAGCATGACTGTTAGTACTTCTCAGGACCCATCTTTCTCAGGATTAAACCAGTTATTCC
TTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGA
TAAAAACCTCACTGGCACTGCCCGATATGCTAGCATCAATGCACATCTTGGTATTGAGCAGAGTCGCCGA
GATGACATGGAATCATTAGGATATGTTTTGATGTATTTTAATAGAACCAGCCTGCCATGGCAAGGGCTAA
AGGCTGCAACAAAGAAACAAAAATATGAAAAGATTAGTGAAAAGAAGATGTCCACGCCTGTTGAAGTTTT
ATGTAAGGGGTTTCCTGCAGAATTTGCGATGTACTTAAACTATTGTCGTGGGCTACGCTTTGAGGAAGCC
CCAGATTACATGTATCTGAGGCAGCTATTCCGCATTCTTTTCAGGACCCTGAACCATCAATATGACTACA
CATTTGATTGGACAATGTTAAAGCAGAAAGCAGCACAGCAGGCAGCCTCTTCCAGTGGGCAGGGTCAGCA
GGCCCAAACCCCCACAGGCAAGCAAACTGACAAAACCAAGAGTAACATGAAAGGTTTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001271742
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271742.1, NP_001258671.1
RefSeq Size 2100 bp
RefSeq ORF 831 bp
Locus ID 1452
Cytogenetics 5q32
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Protein Kinase
Protein Pathways Hedgehog signaling pathway, Wnt signaling pathway
Gene Summary ''
Transcript Variant: This variant (4) differs in the 5' UTR and lacks a portion of the 5' coding region, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (4) with a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.