Casein Kinase 1 alpha (CSNK1A1) (NM_001271742) Human Untagged Clone
CAT#: SC333099
CSNK1A1 (untagged) - Homo sapiens casein kinase 1, alpha 1 (CSNK1A1), transcript variant 4
"NM_001271742" in other vectors (2)
Product Images
Other products for "CSNK1A1"
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CSNK1A1 |
| Synonyms | CK1; CK1a; CKIa; HEL-S-77p; HLCDGP1; PRO2975 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001271742, the custom clone sequence may differ by one or more nucleotides
ATGGATCTTCTGGGACCTAGCCTCGAAGACCTCTTCAATTTCTGTTCAAGAAGGTTCACAATGAAAACTG TACTTATGTTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGA CATTAAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTGTTTAGAATCTCCAGTGGGG AAGAGGAAAAGAAGCATGACTGTTAGTACTTCTCAGGACCCATCTTTCTCAGGATTAAACCAGTTATTCC TTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGA TAAAAACCTCACTGGCACTGCCCGATATGCTAGCATCAATGCACATCTTGGTATTGAGCAGAGTCGCCGA GATGACATGGAATCATTAGGATATGTTTTGATGTATTTTAATAGAACCAGCCTGCCATGGCAAGGGCTAA AGGCTGCAACAAAGAAACAAAAATATGAAAAGATTAGTGAAAAGAAGATGTCCACGCCTGTTGAAGTTTT ATGTAAGGGGTTTCCTGCAGAATTTGCGATGTACTTAAACTATTGTCGTGGGCTACGCTTTGAGGAAGCC CCAGATTACATGTATCTGAGGCAGCTATTCCGCATTCTTTTCAGGACCCTGAACCATCAATATGACTACA CATTTGATTGGACAATGTTAAAGCAGAAAGCAGCACAGCAGGCAGCCTCTTCCAGTGGGCAGGGTCAGCA GGCCCAAACCCCCACAGGCAAGCAAACTGACAAAACCAAGAGTAACATGAAAGGTTTCTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001271742 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001271742.1, NP_001258671.1 |
| RefSeq Size | 2100 bp |
| RefSeq ORF | 831 bp |
| Locus ID | 1452 |
| Cytogenetics | 5q32 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Protein Kinase |
| Protein Pathways | Hedgehog signaling pathway, Wnt signaling pathway |
| Gene Summary | '' Transcript Variant: This variant (4) differs in the 5' UTR and lacks a portion of the 5' coding region, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (4) with a shorter N-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Germany
Japan
United Kingdom
China