PFKFB1 (NM_001271805) Human Untagged Clone

CAT#: SC333119

PFKFB1 (untagged) - Homo sapiens 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 (PFKFB1), transcript variant 3


  "NM_001271805" in other vectors (2)

Reconstitution Protocol

USD 410.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "PFKFB1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PFKFB1
Synonyms F6PK; HL2K; PFRX
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001271805, the custom clone sequence may differ by one or more nucleotides


ATGGAAGAAAAAACCTCTAGAATAAAAGTGTTTAATTTAGGCCAGTATCGACGAGAGGCAGTGAGCTACA
AGAACTATGAATTCTTTCTTCCAGACAACATGGAAGCCCTGCAAATCAGGAAGCAGTGCGCCCTGGCAGC
CCTGAAGGATGTTCACAACTATCTCAGCCATGAGGAAGGTCATGTTGCGGTTTTTGATGCCACCAACACT
ACCAGAGAACGACGGTCACTGATCCTGCAGTTTGCAAAAGAACATGGTTACAAGGTGTTTTTCATTGAGT
CCATTTGTAATGACCCTGGCATAATTGCAGAAAACATCAGGCAAGTGAAACTTGGCAGCCCTGATTATAT
AGACTGTGACCGGGAAAAGGTTCTGGAAGACTTTCTAAAGAGAATTGAGTGCTATGAGGTCAACTACCAA
CCCTTGGATGAGGAACTGGACAGCCACCTGTCCTACATCAAGATCTTCGACGTGGGCACACGCTACATGG
TGAACCGAGTGCAGGATCACATCCAGAGCCGCACAGTCTACTACCTCATGAATATCCATGTCACACCTCG
CTCCATCTACCTTTGCCGACATGGCGAGAGTGAACTCAACATCAGAGGCCGCATCGGAGGTGACTCTGGC
CTCTCAGTTCGCGGCAAGCAGTATGCCTATGCCCTGGCCAACTTCATTCAGTCCCAGGGCATCAGCTCCC
TGAAGGTGTGGACCAGTCACATGAAGAGGACCATCCAGACAGCTGAGGCCCTGGGTGTCCCCTATGAGCA
GTGGAAGGCCCTGAATGAGATTGATGCGGGTGTCTGTGAGGAGATGACCTATGAAGAAATCCAGGAACAT
TACCCTGAAGAATTTGCACTGCGAGACCAAGATAAATATCGCTACCGCTATCCCAAGGGAGAGTCCTATG
AGGATCTGGTTCAGCGTCTGGAGCCAGTGATAATGGAGCTAGAACGACAGGAGAATGTACTGGTGATCTG
CCACCAGGCTGTCATGCGGTGCCTCCTGGCCTATTTCCTGGATAAAAGTTCAGATGAGCTTCCATATCTC
AAGTGCCCTCTGCACACAGTGCTCAAACTCACTCCTGTGGCTTATGGCTGCAAAGTGGAATCCATCTACC
TGAATGTGGAGGCCGTGAACACACACCGGGAGAAGCCTGAGAATGTGGACATCACCCGGGAACCTGAGGA
AGCCCTGGATACTGTCCCAGCCCACTACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001271805
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271805.1, NP_001258734.1
RefSeq Size 1591 bp
RefSeq ORF 1221 bp
Locus ID 5207
Cytogenetics Xp11.21
Protein Families Druggable Genome
Protein Pathways Fructose and mannose metabolism
Gene Summary 'This gene encodes a member of the family of bifunctional 6-phosphofructo-2-kinase:fructose-2,6-biphosphatase enzymes. The enzyme forms a homodimer that catalyzes both the synthesis and degradation of fructose-2,6-biphosphate using independent catalytic domains. Fructose-2,6-biphosphate is an activator of the glycolysis pathway and an inhibitor of the gluconeogenesis pathway. Consequently, regulating fructose-2,6-biphosphate levels through the activity of this enzyme is thought to regulate glucose homeostasis. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2012]'
Transcript Variant: This variant (3) lacks two 5' exons and contains an alternate 5' exon, compared to variant 1. The resulting isoform (3) has a distinct N-terminus and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.