PX19 (PRELID1) (NM_001271828) Human Untagged Clone

CAT#: SC333126

PRELID1 (untagged) - Homo sapiens PRELI domain containing 1 (PRELID1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PRELID1
• Synonyms: CGI-106; PRELI; PX19; SBBI12
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271828, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTGAAGTATTTCCTGGGCCAGAGCGTGCTCCGGAGTTCCTGGGACCAAGTGTTCGCCGCCTTCTGGC
  AGCGGTACCCGAATCCCTATAGCAAACATGTCTTGACGGAAGACATAGTACACCGGGAGGTGACCCCTGA
  CCAGAAACTGCTGTCCCGGCGACTCCTGACCAAGACCAACAGGATGCCACGCTGGGCCGAGCGACTATTT
  CCTGCCAATGTTGCTCACTCGGTGTACGTCCTGGAGGACTCTATTGTGGACCCACAGAATCAGACCATGA
  CTACCTTCACCTGGAACATCAACCACGCCCGGCTGATGGTGGTGGAGGAACGATGTGTTTACTGTGTGAA
  CTCTGACAACAGTGGCTGGACTGAAATCCGCCGGGAAGCCTGGGTCTCCTCTAGCTTATTTGGTGTCTCC
  AGAGCTGTCCAGGAATTTGGTCTTGCCCGATTCAAAAGCAACGTGACCAAGACTATGAAGGGTTTTGAAT
  ATATCTTGGCTAAGCTGCAAGCCAAGGAAGCCAAGGAGAAGGCAAAGGAGACGGCACTGGCAGCTACAGA
  GAAGGCCAAGGACCTCGCCAGCAAGGCGGCCACCAAGAAGCAGCAGCAGCAGCAACAGTTTGTGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271828
• ORF Size: 627 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271828.1, NP_001258757.1
• RefSeq Size: 1255
• RefSeq ORF: 627
• Locus ID: 27166
• Gene Summary: This gene encodes a member of the late embryogenesis abundant motif-containing protein family. The encoded protein is localized to mitochondria and may function as a cytoprotectant by regulating cell death and differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. Several related pseudogenes have been identified. [provided by RefSeq, Nov 2012]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1.