TWIST2 (NM_001271893) Human Untagged Clone
CAT#: SC333148
TWIST2 (untagged) - Homo sapiens twist family bHLH transcription factor 2 (TWIST2), transcript variant 1
"NM_001271893" in other vectors (2)
Product Images
Other products for "TWIST2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TWIST2 |
Synonyms | AMS; BBRSAY; bHLHa39; DERMO1; FFDD3; SETLSS |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001271893, the custom clone sequence may differ by one or more nucleotides
ATGGAGGAGGGCTCCAGCTCGCCCGTGTCCCCCGTGGACAGCCTGGGCACCAGCGAGGAGGAGCTCGAGA GGCAGCCCAAGCGCTTCGGCCGGAAGCGGCGCTACAGCAAGAAGTCGAGCGAAGATGGCAGCCCGACCCC GGGCAAGCGCGGCAAGAAGGGCAGCCCCAGCGCGCAGTCCTTCGAGGAGCTGCAGAGCCAGCGCATCCTG GCCAACGTGCGCGAGCGCCAGCGCACCCAGTCGCTCAACGAGGCCTTCGCGGCGCTGCGCAAGATCATCC CCACGCTGCCCTCTGACAAGCTGAGCAAGATCCAGACGCTCAAGCTGGCCGCCAGGTACATAGACTTCCT CTACCAGGTCCTGCAGAGCGACGAGATGGACAATAAGATGACCAGCTGCAGCTACGTGGCCCACGAGCGC CTCAGCTACGCCTTCTCCGTGTGGCGCATGGAGGGCGCGTGGTCCATGTCCGCCTCCCACTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271893 |
ORF Size | 483 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001271893.2, NP_001258822.1 |
RefSeq Size | 1434 |
RefSeq ORF | 483 |
Locus ID | 117581 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | The protein encoded by this gene is a basic helix-loop-helix type transcription factor and shares similarity with Twist. This protein may inhibit osteoblast maturation and maintain cells in a preosteoblast phenotype during osteoblast development. This gene may be upregulated in certain cancers. Mutations in this gene cause focal facial dermal dysplasia 3, Setleis type. Two transcript variants encoding the same protein have been found. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.