SLC39A1 (NM_001271961) Human Untagged Clone

CAT#: SC333169

SLC39A1 (untagged) - Homo sapiens solute carrier family 39 (zinc transporter), member 1 (SLC39A1), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC39A1
• Synonyms: ZIP1; ZIRTL
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271961, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGCCCTGGGGAGAGCCAGAGCTCCTGGTGTGGCGCCCCGAGGCGGTAGCTTCAGAGCCTCCAGTGC
  CTGTGGGGCTGGAGGTGAAGTTGGGGGCCCTGGTGCTGCTGCTGGTGCTCACCCTCCTCTGCAGCCTGGT
  GCCCATCTGTGTGCTGCGCCGGCCAGGAGCTAACCATGAAGGCTCAGCTCCAGTTCCCACTGCAAGAGTT
  CATCCTGGCCATGGGCTTCTTCCTGGTCCTGGTGATGGAGCAGATCACACTGGCTTACAAGGAGCAGTCA
  GGGCCGTCACCTCTGGAGGAAACAAGGGCTCTGCTGGGAACAGTGAATGGTGGGCCGCAGCATTGGCATG
  A
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271961
• ORF Size: 351 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271961.1, NP_001258890.1
• RefSeq Size: 2024
• RefSeq ORF: 351
• Locus ID: 27173
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a member of the zinc-iron permease family. The encoded protein is localized to the cell membrane and acts as a zinc uptake transporter. This gene has been linked to prostate cancer, breast cancer, and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
  Transcript Variant: This variant (6) differs in the 5' UTR and lacks an exon in the 3' coding region which results in a frameshift, compared to variant 1. The encoded isoform (b) is shorter and has a distinct C-terminus, compared to isoform a.