MMP19 (NM_001272101) Human Untagged Clone

CAT#: SC333211

MMP19 (untagged) - Homo sapiens matrix metallopeptidase 19 (MMP19), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MMP19
• Synonyms: CODA; MMP18; RASI-1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001272101, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACTGCCAGCAGCTGTGGCTGGGCTTCCTACTCCCCATGACAGTCTCAGGCCGGGTCCTGGGGCTTG
  CAGAGGTGGCGCCCGTGGACTACCTGTCACAATATGGGTACCTACAGAAGCCTCTAGAAGGATCTAATAA
  CTTCAAGCCAGAAGATATCACCGAGGCTCTGAGAGCTTTTCAGGAAGCATCTGAACTTCCAGTCTCAGGT
  CAGCTGGATGATGCCACAAGGGCCCGCATGAGGCAGCCTCGTTGTGGCCTAGAGGATCCCTTCAACCAGA
  AGACCCTTAAATACCTGTTGCTGGGCCGCTGGAGAAAGAAGCACCTGACTTTCCGCATCTTGAACCTGCC
  CTCCACCCTTCCACCCCACACAGCCCGGGCAGCCCTGCGTCAAGCCTTCCAGGACTGGAGCAATGTGGCT
  CCCTTGACCTTCCAAGAGGTGCAGGCTGGTGCGGCTGACATCCGCCTCTCCTTCCATGGCCGCCAAAGCT
  CGTACTGTTCCAATACTTTTGATGGGCCTGGCAAGAAGAGTCCAGTGATAAGGGATGAGGAAGAAGAAGA
  GACAGAGCTGCCCACTGTGCCCCCAGTGCCCACAGAACCCAGTCCCATGCCAGACCCTTGCAGTAGTGAA
  CTGGATGCCATGATGCTGGGTGAGGCCCCTCCCCTCCAGGCTGTTGGCAGGCGGTGGGGGCAGCCTGCTG
  ATCCTGAGGCCTGGACAAATGGGAGTGACATGGGACTTCAGCATGAGCAATGGAGGGCCCCGTGGGAAGA
  CCTATGCTTTCAAGGGGGACTATGTGTGGACTGTATCAGATTCAGGACCGGGCCCCTTGTTCCGAGTGTC
  TGCCCTTTGGGAGGGGCTCCCCGGAAACCTGGATGCTGCTGTCTACTCGCCTCGAACACAATGGATTCAC
  TTCTTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001272101
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001272101.1, NP_001259030.1
• RefSeq Size: 3026 bp
• RefSeq ORF: 918 bp
• Locus ID: 4327
• Cytogenetics: 12q13.2
• Protein Families: Protease, Secreted Protein
• Gene Summary: 'This gene encodes a member of a family of proteins that are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded protein is secreted as an inactive proprotein, which is activated upon cleavage by extracellular proteases. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Jan 2013]'
  Transcript Variant: This variant (3) contains multiple differences in the coding region, compared to variant 1, one of which results in a frameshift. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1.