HERPUD1 (NM_001272103) Human Untagged Clone

CAT#: SC333212

HERPUD1 (untagged) - Homo sapiens homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 (HERPUD1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HERPUD1
• Synonyms: HERP; Mif1; SUP
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001272103, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGTCCGAGACCGAACCCGAGCCCGTCACGCTCCTGGTGAAGAGCCCCAACCAGCGCCACCGCGACT
  TGGAGCTGAGTGGCGACCGCGGCTGGAGTGTGGGCCACCTCAAGGCCCACCTGAGCCGCGTCTACCCCGA
  GCGTCCGCGTCCAGAGGACCAGAGGTTAATTTATTCTGGGAAGCTGTTGTTGGATCACCAATGTCTCAGG
  GACTTGCTTCCAAAGCAGGAAAAACGGCATGTTTTGCATCTGGTGTGCAATGTGAAGAGTCCTTCAAAAA
  TGCCAGAAATCAACGCCAAGGTGGCTGAATCCACAGAGGAGCCTGCTGGTTCTAATCGGGGACAGTATCC
  TGAGGATTCCTCAAGTGATGGTTTAAGGCAAAGGGAAGTTCTTCGGAACCTTTCTTCCCCTGGATGGGAA
  AACATCTCAAGGCCTGAAGCTGCCCAGCAGGCATTCCAAGGCCTGGGTCCTGGTTTCTCCGGTTACACAC
  CCTATGGGTGGCTTCAGCTTTCCTGGTTCCAGCAGATATATGCACGACAGTACTACATGCAATATTTAGC
  AGCCACTGCTGCATCAGGGGCTTTTGTTCCACCACCAAGTGCACAAGAGATACCTGTGGTCTCTGCACCT
  GCTCCAGCCCCTATTCACAACCAGTTTCCAGCTGAAAACCAGCCTGCCAATCAGAATGCTGCTCCTCAAG
  TGGTTGTTAATCCTGGAGCCAATCAAAATTTGCGGATGAATGCACAAGGCATCACGTTGGGTGGTTTCCA
  TTTAGACCGAGGCCGGTTCAGAACTTCCCAAATGATGGTCCTCCTCCTGACGTTGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001272103
• ORF Size: 828 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001272103.1, NP_001259032.1
• RefSeq Size: 1787
• RefSeq ORF: 828
• Locus ID: 9709
• Protein Families: Druggable Genome
• Gene Summary: The accumulation of unfolded proteins in the endoplasmic reticulum (ER) triggers the ER stress response. This response includes the inhibition of translation to prevent further accumulation of unfolded proteins, the increased expression of proteins involved in polypeptide folding, known as the unfolded protein response (UPR), and the destruction of misfolded proteins by the ER-associated protein degradation (ERAD) system. This gene may play a role in both UPR and ERAD. Its expression is induced by UPR and it has an ER stress response element in its promoter region while the encoded protein has an N-terminal ubiquitin-like domain which may interact with the ERAD system. This protein has been shown to interact with presenilin proteins and to increase the level of amyloid-beta protein following its overexpression. Alternative splicing of this gene produces multiple transcript variants encoding different isoforms. The full-length nature of all transcript variants has not been determined. [provided by RefSeq, Jan 2013]
  Transcript Variant: This variant (4) uses an alternate splice site in the 3' coding region compared to variant 1, that causes a frameshift. The resulting isoform (4) has a shorter and distinct C-terminus compared to isoform 1.