DUOXA1 (NM_001276266) Human Untagged Clone

CAT#: SC333227

DUOXA1 (untagged) - Homo sapiens dual oxidase maturation factor 1 (DUOXA1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DUOXA1
• Synonyms: mol; NIP; NUMBIP
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001276266, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTACTTTGGGACACACATTCCCCTTCTATGCTGGCCCCAAGCCAACCTTCCCGATGGACACCACTT
  TGGCCAGCATCATCATGATCTTTCTGACTGCACTGGCCACGTTCATCGTCATCCTGCCTGGCATTCGGGG
  AAAGACGAGGCTGTTCTGGCTGCTTCGGGTGGTGACCAGCTTATTCATCGGGGCTGCAATCCTGGCTGTG
  AATTTCAGTTCTGAGTGGTCTGTGGGCCAGGTCAGCACCAACACATCATACAAGGCCTTCAGTTCTGAGT
  GGATCAGCGCTGATATTGGGCTGCAGGTCGGGCTGGGTGGAGTCAACATCACACTCACAGGGACCCCCGT
  GCAGCAGCTGAATGAGACCATCAATTACAACGAGGAGTTCACCTGGCGCCTGGGTGAGAACTATGCTGAG
  GAGTATGCAAAGGCTCTGGAGAAGGGGCTGCCAGACCCTGTGTTGTACCTAGCTGAGAAGTTCACTCCAA
  GAAGCCCATGTGGCCTATACCGCCAGTACCGCCTGGCGGGACACTACACCTCAGCCATGCTATGGGTGGC
  ATTCCTCTGCTGGCTGCTGGCCAATGTGATGCTCTCCATGCCTGTGCTGGTATATGGTGGCTACATGCTA
  TTGGCCACGGGCATCTTCCAGCTGTTGGCTCTGCTCTTCTTCTCCATGGCCACATCACTCACCTCACCCT
  GTCCCCTGCACCTGGGCGCTTCTGTGCTGCATACTCACCATGGGCCTGCCTTCTGGATCACATTGACCAC
  AGGACTGCTGTGTGTGCTGCTGGGCCTGGCTATGGCGGTGGCCCACAGGATGCAGCCTCACAGGCTGAAG
  GCTTTCTTCAACCAGAGTGTGGATGAAGACCCCATGCTGGAGTGGAGTCCTGAGGAAGGTGGACTCCTGA
  GCCCCCGCTACCGGTCCATGGCTGACAGTCCCAAGTCCCAGGACATTCCCCTGTCAGAGGCTTCCTCCAC
  CAAGGCATACTGTAAGGAGGCACACCCCAAAGATCCTGATTGTGCTTTATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001276266
• ORF Size: 1032 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001276266.1, NP_001263195.1
• RefSeq Size: 1111
• RefSeq ORF: 1032
• Locus ID: 90527
• Protein Families: Transmembrane
• Gene Summary: Dual oxidases DUOX1 and DUOX2 are NADPH oxidases which are involved in hydrogen peroxide production necessary for thyroid hormonogenesis. They form a heterodimer with specific maturation factors DUOXA1 and DUOXA2, respectively, which is essential for the maturation and function of the DUOX enzyme complexes. This gene encodes the DUOX1 activator or maturation factor DUOXA1. Rat studies identified a bidirectional promoter which controls the transcription of the DUOX1 and DUOXA1 genes. This protein is cotransported to the cell surface when coexpressed with DUOX1 and is retained in the endoplasmic reticulum when expressed without DUOX1 protein. The expression of this gene or the DUOX1 gene is not suppressed by thyroglobulin (Tg), a macromolecular precursor in thyroid hormone synthesis, while the expression of the DUOX2 and DUOXA2 are significantly suppressed by the Tg. This protein is also a p53-regulated neurogenic factor involved in p53 dependent neuronal differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
  Transcript Variant: This variant (4) lacks two exons and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. The resulting isoform (3, also known as alpha) is shorter and has a distinct C-terminus, compared to isoform 1.