DUOXA1 (NM_001276266) Human Untagged Clone

CAT#: SC333227

DUOXA1 (untagged) - Homo sapiens dual oxidase maturation factor 1 (DUOXA1), transcript variant 4


  "NM_001276266" in other vectors (2)

Reconstitution Protocol

USD 350.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "DUOXA1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DUOXA1
Synonyms mol; NIP; NUMBIP
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001276266, the custom clone sequence may differ by one or more nucleotides


ATGGCTACTTTGGGACACACATTCCCCTTCTATGCTGGCCCCAAGCCAACCTTCCCGATGGACACCACTT
TGGCCAGCATCATCATGATCTTTCTGACTGCACTGGCCACGTTCATCGTCATCCTGCCTGGCATTCGGGG
AAAGACGAGGCTGTTCTGGCTGCTTCGGGTGGTGACCAGCTTATTCATCGGGGCTGCAATCCTGGCTGTG
AATTTCAGTTCTGAGTGGTCTGTGGGCCAGGTCAGCACCAACACATCATACAAGGCCTTCAGTTCTGAGT
GGATCAGCGCTGATATTGGGCTGCAGGTCGGGCTGGGTGGAGTCAACATCACACTCACAGGGACCCCCGT
GCAGCAGCTGAATGAGACCATCAATTACAACGAGGAGTTCACCTGGCGCCTGGGTGAGAACTATGCTGAG
GAGTATGCAAAGGCTCTGGAGAAGGGGCTGCCAGACCCTGTGTTGTACCTAGCTGAGAAGTTCACTCCAA
GAAGCCCATGTGGCCTATACCGCCAGTACCGCCTGGCGGGACACTACACCTCAGCCATGCTATGGGTGGC
ATTCCTCTGCTGGCTGCTGGCCAATGTGATGCTCTCCATGCCTGTGCTGGTATATGGTGGCTACATGCTA
TTGGCCACGGGCATCTTCCAGCTGTTGGCTCTGCTCTTCTTCTCCATGGCCACATCACTCACCTCACCCT
GTCCCCTGCACCTGGGCGCTTCTGTGCTGCATACTCACCATGGGCCTGCCTTCTGGATCACATTGACCAC
AGGACTGCTGTGTGTGCTGCTGGGCCTGGCTATGGCGGTGGCCCACAGGATGCAGCCTCACAGGCTGAAG
GCTTTCTTCAACCAGAGTGTGGATGAAGACCCCATGCTGGAGTGGAGTCCTGAGGAAGGTGGACTCCTGA
GCCCCCGCTACCGGTCCATGGCTGACAGTCCCAAGTCCCAGGACATTCCCCTGTCAGAGGCTTCCTCCAC
CAAGGCATACTGTAAGGAGGCACACCCCAAAGATCCTGATTGTGCTTTATAA


Restriction Sites SgfI-MluI     
ACCN NM_001276266
ORF Size 1032 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001276266.1, NP_001263195.1
RefSeq Size 1111
RefSeq ORF 1032
Locus ID 90527
Protein Families Transmembrane
Gene Summary Dual oxidases DUOX1 and DUOX2 are NADPH oxidases which are involved in hydrogen peroxide production necessary for thyroid hormonogenesis. They form a heterodimer with specific maturation factors DUOXA1 and DUOXA2, respectively, which is essential for the maturation and function of the DUOX enzyme complexes. This gene encodes the DUOX1 activator or maturation factor DUOXA1. Rat studies identified a bidirectional promoter which controls the transcription of the DUOX1 and DUOXA1 genes. This protein is cotransported to the cell surface when coexpressed with DUOX1 and is retained in the endoplasmic reticulum when expressed without DUOX1 protein. The expression of this gene or the DUOX1 gene is not suppressed by thyroglobulin (Tg), a macromolecular precursor in thyroid hormone synthesis, while the expression of the DUOX2 and DUOXA2 are significantly suppressed by the Tg. This protein is also a p53-regulated neurogenic factor involved in p53 dependent neuronal differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (4) lacks two exons and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. The resulting isoform (3, also known as alpha) is shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.