APELA (NM_001297550) Human Untagged Clone

CAT#: SC333312

APELA (untagged) - Human apelin receptor early endogenous ligand (APELA)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: APELA
• Synonyms: ELA; Ende; tdl
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001297550, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGATTTCAGCAATTCCTTTTTGCATTTTTTATTTTTATTATGAGTCTTCTCCTTATCAGCGGACAGA
  GACCAGTTAATTTGACCATGAGAAGAAAACTGCGCAAACACAATTGCCTTCAGAGGAGATGTATGCCTCT
  CCATTCACGAGTACCCTTTCCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001297550
• ORF Size: 165 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001297550.1, NP_001284479.1
• RefSeq Size: 2622
• RefSeq ORF: 165
• Locus ID: 100506013
• Gene Summary: This gene encodes a peptide hormone that binds to the Apelin receptor. The encoded protein is required for heart development in zebrafish and has been shown to maintain self-renewal of human embryonic stem cells through activation of the PI3K/AKT pathway. Experiments in human and mouse cell lines point to additional roles for the encoded protein in angiogenesis and regulation of vascular tone. [provided by RefSeq, Jul 2016]