PCBD1 (NM_001289797) Human Untagged Clone

CAT#: SC333313

PCBD1 (untagged) - Human pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (PCBD1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PCBD1
• Synonyms: DCOH; PCBD; PCD; PHS
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001289797, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACAAGAGTGGCCCTGCAGGCTGAGAAACTGGACCACCATCCTGAATGGTTTAACGTGTACAACAAGG
  TCCACATCACGCTGAGCACCCATGAGTGTGCCGGCCTTTCAGAACGGGACATAAACCTGGCCAGCTTCAT
  CGAACAAGTAGCAGTGTCCATGACATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001289797
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001289797.1, NP_001276726.1
• RefSeq Size: 1165 bp
• RefSeq ORF: 168 bp
• Locus ID: 5092
• Cytogenetics: 10q22.1
• Protein Families: Druggable Genome
• Gene Summary: 'This gene encodes a member of the pterin-4-alpha-carbinolamine dehydratase family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein functions as both a dehydratase involved in tetrahydrobiopterin biosynthesis, and as a cofactor for HNF1A-dependent transcription. A deficiency of this enzyme leads to hyperphenylalaninemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]'
  Transcript Variant: This variant (3) differs in the 5' UTR and uses a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1.