LYRM7 (NM_001293735) Human Untagged Clone

CAT#: SC333330

LYRM7 (untagged) - Human LYR motif containing 7 (LYRM7), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LYRM7
• Synonyms: C5orf31; MC3DN8; MZM1L
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001293735, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGACGGGCAGTCAAGGTTTTACAGCTCTTTAAAACACTGCACAGGACCAGACAACAAGTTTTTAAAA
  ATGATGCCAGAGCATTAGAAGCAGCCAGAATAAAGATAAATGAAGAATTCAAAAATAATAAAAGTGAAAC
  TTCTTCTAAGAAAATAGAAGAGAACTGGTCCCTAGGAAAGACCTTCTTGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001293735
• ORF Size: 192 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001293735.1, NP_001280664.1
• RefSeq Size: 6165
• RefSeq ORF: 192
• Locus ID: 90624
• Gene Summary: Inner mitochondrial membrane complex III (CIII) is the main enzyme complex in the mitochondrial respiratory chain, and Rieske Fe-S protein (UQCRFS1) is the last catalytic subunit added to the complex. The protein encoded by this gene is a nuclear-encoded mitochondrial matrix protein that stabilizes UQCRFS1 and chaperones it to the CIII complex. Defects in this gene are a cause of mitochondrial complex III deficiency, nuclear type 8. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
  Transcript Variant: This variant (2) lacks an alternate exon compared to variant 1, that causes a frameshift. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.