Macrophage Inflammatory Protein 1 beta (CCL4L2) (NM_001291470) Human Untagged Clone
CAT#: SC333334
CCL4L2 (untagged) - Human chemokine (C-C motif) ligand 4-like 2 (CCL4L2), transcript variant CCL4L2b2
"NM_001291470" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CCL4L2 |
Synonyms | AT744.2; CCL4L; SCYA4L; SCYQ4L2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001291470, the custom clone sequence may differ by one or more nucleotides
ATGAAGCTCTGCGTGACTGTCCTGTCTCTCCTCGTGCTAGTAGCTGCCTTCTGCTCTCTAGCACTCTCAG CACCAATGGGCTCAGACCCTCCCACCGCCTGCTGCTTTTCTTACACCGCGAGGAAGCTTCCTCGCAACTT TGTGGTAGATTACTATGAGACCAGCAGCCTCTGCTCCCAGCCAGCTGTGGTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291470 |
ORF Size | 195 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001291470.1, NP_001278399.1 |
RefSeq Size | 1258 |
RefSeq ORF | 195 |
Locus ID | 9560 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway |
Gene Summary | This gene is one of several cytokine genes that are clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins that function in inflammatory and immunoregulatory processes. The protein encoded by this family member is similar to the chemokine (C-C motif) ligand 4 product, which inhibits HIV entry by binding to the cellular receptor CCR5. The copy number of this gene varies among individuals, where most individuals have one to five copies. This gene copy contains a non-consensus splice acceptor site at the 3' terminal exon found in other highly similar gene copies, and it thus uses other alternative splice sites for the 3' terminal exon, resulting in multiple transcript variants. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (CCL4L2b2) fails to splice out the 3'-most intron, and it thus contains an early termination codon and differs in its 3' UTR, compared to variant CCL4L2. The encoded isoform (2) is shorter at the C-terminus, compared to isoform 1. Both variants CCL4L2b1 and CCL4L2b2 encode isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235440 | CCL4L2 (myc-DDK-tagged) - Human chemokine (C-C motif) ligand 4-like 2 (CCL4L2), transcript variant CCL4L2b2 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review