DEFB134 (NM_001302695) Human Untagged Clone

CAT#: SC333337

DEFB134 (untagged) - Human defensin, beta 134 (DEFB134)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DEFB134
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001302695, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGCCTCTCCTTGTTGTGTTTGTCTTTCTTTTCCTTTGGGATCCAGTGCTGGCAGGTATAAATTCAT
  TATCATCAGAAATGCACAAGAAATGCTATAAAAATGGCATCTGCAGACTTGAATGCTATGAGAGTGAAAT
  GTTAGTTGCCTACTGTATGTTTCAGCTGGAGTGCTGTGTCAAAGGAAATCCTGCACCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302695
• ORF Size: 201 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001302695.1, NP_001289624.1
• RefSeq Size: 1096
• RefSeq ORF: 201
• Locus ID: 613211
• Protein Families: Secreted Protein, Transmembrane
• Gene Summary: Defensins are cysteine-rich cationic polypeptides that are important in the immunologic response to invading microorganisms. The antimicrobial protein encoded by this gene is secreted and is a member of the beta defensin protein family. Beta defensin genes are found in several clusters throughout the genome, with this gene mapping to a cluster at 8p23. [provided by RefSeq, Nov 2014]