Surb7 (MED21) (NM_001271811) Human Untagged Clone

CAT#: SC333342

MED21 (untagged) - Human mediator complex subunit 21 (MED21), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MED21
• Synonyms: hSrb7; SRB7; SURB7
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271811, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGATCGGCTCACGCAGCTTCAGGACGCTGTGAATTCGCTTGCAGATCAGTTTTGTAATGCCATTG
  GAGTATTGCAGCAATGTGGTCCTCCTGCCTCTTTCAATAATATTCAGACAGCAATTAACAAAGACCAGCC
  AGCTAACCCTACAGAAGTATGCCCAGCTTTTTGCAGCACTGATTGCACGAACAGCAAAAGACATTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271811
• ORF Size: 207 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271811.1, NP_001258740.1
• RefSeq Size: 2703
• RefSeq ORF: 207
• Locus ID: 9412
• Protein Families: Transcription Factors
• Gene Summary: This gene encodes a member of the mediator complex subunit 21 family. The encoded protein interacts with the human RNA polymerase II holoenzyme and is involved in transcriptional regulation of RNA polymerase II transcribed genes. A pseudogene of this gene is located on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
  Transcript Variant: This variant (2) uses an alternate splice site in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.