Cylicin 1 (CYLC1) (NM_001271680) Human Untagged Clone

CAT#: SC333344

CYLC1 (untagged) - Human cylicin, basic protein of sperm head cytoskeleton 1 (CYLC1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CYLC1
• Synonyms: CYCL1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271680, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCTCTTCCAAGGCTAAAAGTAAACATCAGAACATATGATAATTCCATTCCAATCAGTGAATCAAGCA
  GAAAATCATGGAATCAAAAACACTTTGCTTTGACATTTCCCAAACCACTCCAGAGAGGTACAAATGATAA
  ATCAAGACCTTTGAAATCACAAATAACAGTTACTCCTGAAGCACCGTGGATTCATAAGCTGCTTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271680
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001271680.1, NP_001258609.1
• RefSeq Size: 394 bp
• RefSeq ORF: 207 bp
• Locus ID: 1538
• Cytogenetics: Xq21.1
• Gene Summary: 'This gene encodes a sperm head cytoskeletal protein. The encoded protein is associated with the calyx of spermatozoa and spermatids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]'
  Transcript Variant: This variant (2) uses an alternate in-frame splice site and lacks an alternate in-frame exon compared to variant 1. It encodes a shorter protein (isoform 2) compared to isoform 1.