CDK2AP2 (NM_001271849) Human Untagged Clone

CAT#: SC333348

CDK2AP2 (untagged) - Human cyclin-dependent kinase 2 associated protein 2 (CDK2AP2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CDK2AP2
• Synonyms: DOC-1R; p14
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271849, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCTACGTGCAGGCGATGAAGCCACCCGGCGCCCAGGGCTCCCAGAGCACCTACACGGACCTGCTGT
  CAGTCATAGAGGAGATGGGCAAAGAGATCCGGCCTACCTATGCTGGCAGCAAGAGCGCCATGGAGCGCCT
  GAAGAGAGGTATCATCCATGCCCGGGCCCTAGTCAGAGAGTGCCTGGCAGAGACAGAGCGGAACGCCCGC
  ACGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271849
• ORF Size: 216 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271849.1, NP_001258778.1
• RefSeq Size: 1099
• RefSeq ORF: 216
• Locus ID: 10263
• Gene Summary: This gene encodes a protein that interacts with cyclin-dependent kinase 2 associated protein 1. Pseudogenes associated with this gene are located on chromosomes 7 and 9. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]
  Transcript Variant: This variant (2) contains an alternate 5' terminal exon and uses a downstream start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1.