UFM1 (NM_001286706) Human Untagged Clone

CAT#: SC333351

UFM1 (untagged) - Human ubiquitin-fold modifier 1 (UFM1), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UFM1
• Synonyms: BM-002; C13orf20; HLD14
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001286706, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCGAAGGTTTCCTTTAAGATCACGCTGACGTCGGACCCACGGCTGCCGTACAAAGTACTCAGTGTTC
  CTGAAAGTACACCTTTCACAGCAGTCTTAAAGTTTGCAGCAGAAGAATTTAAAGTTCCTGCTGCAACAAG
  TGCAATTATTACCAATGATGGAATAGGAATAAATCCTGCACAGACTGCTGGCCTTGCAGTTGAAATTCAG
  CCATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001286706
• ORF Size: 216 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001286706.1, NP_001273635.1
• RefSeq Size: 3306
• RefSeq ORF: 216
• Locus ID: 51569
• Gene Summary: UFM1 is a ubiquitin-like protein that is conjugated to target proteins by E1-like activating enzyme UBA5 (UBE1DC1; MIM 610552) and E2-like conjugating enzyme UFC1 (MIM 610554) in a manner analogous to ubiquitylation (see UBE2M; MIM 603173) (Komatsu et al., 2004 [PubMed 15071506]). [supplied by OMIM, Dec 2008]
  Transcript Variant: This variant (5) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (4) has a distinct C-terminus and is shorter than isoform 1. Variants 4 and 5 encode the same isoform (4). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.