UFM1 (NM_001286706) Human Untagged Clone

CAT#: SC333351

UFM1 (untagged) - Human ubiquitin-fold modifier 1 (UFM1), transcript variant 5


  "NM_001286706" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "UFM1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UFM1
Synonyms BM-002; C13orf20; HLD14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286706, the custom clone sequence may differ by one or more nucleotides


ATGTCGAAGGTTTCCTTTAAGATCACGCTGACGTCGGACCCACGGCTGCCGTACAAAGTACTCAGTGTTC
CTGAAAGTACACCTTTCACAGCAGTCTTAAAGTTTGCAGCAGAAGAATTTAAAGTTCCTGCTGCAACAAG
TGCAATTATTACCAATGATGGAATAGGAATAAATCCTGCACAGACTGCTGGCCTTGCAGTTGAAATTCAG
CCATAA


Restriction Sites SgfI-MluI     
ACCN NM_001286706
ORF Size 216 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001286706.1, NP_001273635.1
RefSeq Size 3306
RefSeq ORF 216
Locus ID 51569
Gene Summary UFM1 is a ubiquitin-like protein that is conjugated to target proteins by E1-like activating enzyme UBA5 (UBE1DC1; MIM 610552) and E2-like conjugating enzyme UFC1 (MIM 610554) in a manner analogous to ubiquitylation (see UBE2M; MIM 603173) (Komatsu et al., 2004 [PubMed 15071506]). [supplied by OMIM, Dec 2008]
Transcript Variant: This variant (5) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (4) has a distinct C-terminus and is shorter than isoform 1. Variants 4 and 5 encode the same isoform (4). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.