Glutathione S Transferase theta 1 (GSTT1) (NM_001293814) Human Untagged Clone

CAT#: SC333353

GSTT1 (untagged) - Human glutathione S-transferase theta 1 (GSTT1), transcript variant 9


  "NM_001293814" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "GSTT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GSTT1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001293814, the custom clone sequence may differ by one or more nucleotides


ATGGGCCTGGAGCTGTACCTGGACCTGCTGTCCCAGCCCTGCCGCGCTGTTTACATCTTTGCCAAGAAGA
ACGACATTCCCTTCGAGCTGCGCATCGTGGATCTGATTAAAGCCCGTGGGTGCTGGCTGCCAAGTCTTCG
AAGGCCGACCCAAGCTGGCCACATGGCGGCAGCGCGTGGAGGCAGCAGTGGGGGAGGACCTCTTCCAGGA
GGCCCATGA


Restriction Sites SgfI-MluI     
ACCN NM_001293814
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001293814.1, NP_001280743.1
RefSeq Size 693 bp
RefSeq ORF 219 bp
Locus ID 2952
Cytogenetics 22q11.23
Protein Pathways Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450
Gene Summary 'The protein encoded by this gene, glutathione S-transferase (GST) theta 1 (GSTT1), is a member of a superfamily of proteins that catalyze the conjugation of reduced glutathione to a variety of electrophilic and hydrophobic compounds. Human GSTs can be divided into five main classes: alpha, mu, pi, theta, and zeta. The theta class includes GSTT1, GSTT2, and GSTT2B. GSTT1 and GSTT2/GSTT2B share 55% amino acid sequence identity and may play a role in human carcinogenesis. The GSTT1 gene is haplotype-specific and is absent from 38% of the population. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2015]'
Transcript Variant: This variant (9) lacks three alternate exons, resulting in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (e) has a distinct C-terminus and is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.