Bestrophin 3 (BEST3) (NM_001282615) Human Untagged Clone

CAT#: SC333354

BEST3 (untagged) - Human bestrophin 3 (BEST3), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BEST3
• Synonyms: VMD2L3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282615, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTCCTCATCTCTAGCAGTGTTCACGGAAGCGACGAGCACGGGCGCCTGCTTAGAAGGACGCTGATGC
  GCTACGTCAATCTCACCTCCCTGCTCATCTTTCGCTCGGTGAGCACTGCTGTGTACAAAAGATTTCCCAC
  AATGGACCACGTGGTTGAAGCAGAAAGAACTGGCATGAAACCCATTCTGCCTTCAAGTTTTGAGATGCAG
  AGCTTTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282615
• ORF Size: 219 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001282615.1, NP_001269544.1
• RefSeq Size: 1848
• RefSeq ORF: 219
• Locus ID: 144453
• Protein Families: Ion Channels: Other, Transmembrane
• Gene Summary: BEST3 belongs to the bestrophin family of anion channels, which includes BEST1 (MIM 607854), the gene mutant in vitelliform macular dystrophy (VMD; MIM 153700), and 2 other BEST1-like genes, BEST2 (MIM 607335) and BEST4 (MIM 607336). Bestrophins are transmembrane (TM) proteins that share a homology region containing a high content of aromatic residues, including an invariant arg-phe-pro (RFP) motif. The bestrophin genes share a conserved gene structure, with almost identical sizes of the 8 RFP-TM domain-encoding exons and highly conserved exon-intron boundaries. Each of the 4 bestrophin genes has a unique 3-prime end of variable length (Stohr et al., 2002 [PubMed 12032738]; Tsunenari et al., 2003 [PubMed 12907679]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (5) lacks a portion of the 5' UTR and 5' coding region, uses a downstream in-frame start codon, and lacks several 3' exons but includes an alternate 3' terminal exon, compared to variant 1. The encoded isoform (5) is shorter at the N-terminus, has a distinct C-terminus and is significantly shorter than isoform 1. Both variants 5 and 6 encode isoform 5. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.