Apg12 (ATG12) (NM_001277783) Human Untagged Clone

CAT#: SC333360

ATG12 (untagged) - Human autophagy related 12 (ATG12), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATG12
• Synonyms: APG12; APG12L; FBR93; HAPG12
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001277783, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGAGGAGCCGCAGTCTGTGTTGCAGCTTCCTACTTCAATTGCTGCTGGAGGGGAAGGACTTACGG
  ATGTCTCCCCAGAAACAACCACCCCGGAGCCCCCGTCTTCCGCTGCAGTTTCCCCGGGAACAGAGGAACC
  TGCTGGCGACACCAAGAAAAAAATTTATTTATGTGAATCAGTCCTTTGCTCCTTCCCCAGACCAAGAAGT
  TGGAACTCTCTATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001277783
• ORF Size: 225 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001277783.1, NP_001264712.1
• RefSeq Size: 4193
• RefSeq ORF: 225
• Locus ID: 9140
• Protein Pathways: Regulation of autophagy, RIG-I-like receptor signaling pathway
• Gene Summary: Autophagy is a process of bulk protein degradation in which cytoplasmic components, including organelles, are enclosed in double-membrane structures called autophagosomes and delivered to lysosomes or vacuoles for degradation. ATG12 is the human homolog of a yeast protein involved in autophagy (Mizushima et al., 1998 [PubMed 9852036]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (5) lacks an exon in the coding region compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.