PKIG (NM_001281444) Human Untagged Clone

CAT#: SC333374

PKIG (untagged) - Human protein kinase (cAMP-dependent, catalytic) inhibitor gamma (PKIG), transcript variant 4


  "NM_001281444" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "PKIG"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PKIG
Synonyms PKI-gamma
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001281444, the custom clone sequence may differ by one or more nucleotides


ATGATGGAGGTCGAGTCCTCCTACTCGGACTTCATCTCCTGTGACCGGACAGGCCGTCGGAATGCGGTCC
CTGACATCCAGGGAGACTCAGAGGCTGTGAGCGTGAGGAAGCTGGCTGGAGACATGGGCGAGCTGGCACT
CGAGGGGGCAGAAGGACAGGTGGAGGGAAGCGCCCCAGACAAGGAAGCTGGCAACCAGCCCCAGAGCAGC
GATGGGACCACCTCGTCTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001281444
ORF Size 231 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001281444.1, NP_001268373.1
RefSeq Size 1623
RefSeq ORF 231
Locus ID 11142
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the protein kinase inhibitor family. Studies of a similar protein in mice suggest that this protein acts as a potent competitive cAMP-dependent protein kinase inhibitor, and is a predominant form of inhibitor in various tissues. The encoded protein may be involved in osteogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (4) represents the longest transcript. Variants 1-5 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.