PKIG (NM_001281445) Human Untagged Clone

CAT#: SC333375

PKIG (untagged) - Human protein kinase (cAMP-dependent, catalytic) inhibitor gamma (PKIG), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PKIG
• Synonyms: PKI-gamma
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001281445, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATGGAGGTCGAGTCCTCCTACTCGGACTTCATCTCCTGTGACCGGACAGGCCGTCGGAATGCGGTCC
  CTGACATCCAGGGAGACTCAGAGGCTGTGAGCGTGAGGAAGCTGGCTGGAGACATGGGCGAGCTGGCACT
  CGAGGGGGCAGAAGGACAGGTGGAGGGAAGCGCCCCAGACAAGGAAGCTGGCAACCAGCCCCAGAGCAGC
  GATGGGACCACCTCGTCTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001281445
• ORF Size: 231 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001281445.1, NP_001268374.1
• RefSeq Size: 1186
• RefSeq ORF: 231
• Locus ID: 11142
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a member of the protein kinase inhibitor family. Studies of a similar protein in mice suggest that this protein acts as a potent competitive cAMP-dependent protein kinase inhibitor, and is a predominant form of inhibitor in various tissues. The encoded protein may be involved in osteogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (5) differs in the 5' UTR, compared to variant 4. Variants 1-5 encode the same protein.