NDUFA5 (NM_001282422) Human Untagged Clone

CAT#: SC333380

NDUFA5 (untagged) - Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5 (NDUFA5), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NDUFA5
• Synonyms: B13; CI-13kB; CI-13KD-B; NUFM; UQOR13
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282422, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGGTGTGCTGAAGAAGACCACTGGCCTTGTGGGATTGGCTGTGTGCAATACTCCTCACGAGGAAC
  CAGATGTTAAAAAATTAGAAGACCAACTTCAAGGCGGTCAATTAGAAGAGGTGATTCTTCAGGCTGAACA
  TGAACTAAATCTGGCAAGAAAAATGAGGGAATGGAAACTATGGGAGCCATTAGTGGAAGAGCCTCCTGCC
  GATCAGTGGAAATGGCCAATATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282422
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282422.2, NP_001269351.1
• RefSeq Size: 5485 bp
• RefSeq ORF: 234 bp
• Locus ID: 4698
• Cytogenetics: 7q31.32
• Protein Pathways: Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
• Gene Summary: 'This nuclear gene encodes a conserved protein that comprises the B13 subunit of complex I of the mitochondrial respiratory chain. The encoded protein localizes to the inner mitochondrial membrane, where it is thought to aid in the transfer of electrons from NADH to ubiquinone. Alternative splicing results in multiple transcript variants. There are numerous pseudogenes of this gene on chromosomes 1, 3, 6, 8, 9, 11, 12, and 16. [provided by RefSeq, Apr 2014]'
  Transcript Variant: This variant (5) lacks an alternate in-frame exon in the central coding region, compared to variant 1. The encoded isoform (5) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.