IFI27 (NM_001288959) Human Untagged Clone

CAT#: SC333390

IFI27 (untagged) - Human interferon, alpha-inducible protein 27 (IFI27), transcript variant 8


  "NM_001288959" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "IFI27"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IFI27
Synonyms FAM14D; ISG12; ISG12A; P27
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001288959, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCTGTGCCCATGGTGCTCAGTGCCATGGGCTTCACTGCGGCGGGAATCGCCTCGTCCTCCATAG
CAGCCAAGATGATGTCCGCGGCGGCCATTGCCAATGGGGGTGGAGTTGCCTCGGGCAGCCTTGTGGCTAC
TCTGCAGTCACTGGGAGCAACTGGACTCTCCGGATTGACCAAGTTCATCCTGGGCTCCATTGGGTCTGCC
ATTGCGGCTGTCATTGCGAGGTTCTACTAG


Restriction Sites SgfI-MluI     
ACCN NM_001288959
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001288959.1, NP_001275888.1
RefSeq Size 532 bp
RefSeq ORF 240 bp
Locus ID 3429
Cytogenetics 14q32.12
Protein Families Transmembrane
Gene Summary ''
Transcript Variant: This variant (8) lacks an internal exon in the 5' region which results in translation initiation at a downstream AUG codon, compared to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus, compared to isoform 1. This variant corresponds to the allele present in the GRC reference assembly.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.