MGST2 (NM_001204367) Human Untagged Clone

CAT#: SC333392

MGST2 (untagged) - Human microsomal glutathione S-transferase 2 (MGST2), transcript variant 3


  "NM_001204367" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "MGST2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MGST2
Synonyms GST2; MGST-II
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001204367, the custom clone sequence may differ by one or more nucleotides


ATGGCTGGGTGGTATTTCAACCAAGTTTTTGCTACTTGTCTGGGTCTGGTGTACATATATGGCCGTCACC
TATACTTCTGGGGATATTCAGAAGCTGCTAAAAAACGGATCACCGGTTTCCGACTGAGTCTGGGGATTTT
GGCCTTGTTGACCCTCCTAGGTGCCCTGGGAATTGCAAACAGCTTTCTGGATGAATATCTGGACCTCAAT
ATTGCCAAGAAACTGAGGCGGCAATTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001204367
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204367.1, NP_001191296.1
RefSeq Size 1178 bp
RefSeq ORF 240 bp
Locus ID 4258
Cytogenetics 4q31.1
Protein Families Druggable Genome, Transmembrane
Protein Pathways Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450
Gene Summary 'The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, several of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. This gene encodes a protein which catalyzes the conjugation of leukotriene A4 and reduced glutathione to produce leukotriene C4. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2011]'
Transcript Variant: This variant (3) lacks an exon in the 5' region, which results in a downstream AUG start codon, and has an alternate 3' UTR, as compared to variant 1. The resulting isoform (2) is shorter at the N-terminus, as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.