UBE2C (NM_001281742) Human Untagged Clone

CAT#: SC333393

UBE2C (untagged) - Human ubiquitin-conjugating enzyme E2C (UBE2C), transcript variant 8


  "NM_001281742" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "UBE2C"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UBE2C
Synonyms dJ447F3.2; UBCH10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001281742, the custom clone sequence may differ by one or more nucleotides


ATGGCTTCCCAAAACCGCGACCCAGCCGCCACTAGCGTCGCCGCCGCCCGTAAAGGAGCTGAGCCGAGCG
GGGGCGCCGCCCGGGGTCCGGTGGGCAAAAGGCTACAGCAGGAGCTGATGACCCTCATGATGTCTGGCGA
TAAAGGGATTTCTGCCTTCCCTGAATCAGACAACCTTTTCAAATGGGTAGGGACCATCCATGGAGCAGCT
GGAACAAACCCAACATTGATAGTCCCTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001281742
ORF Size 240 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001281742.1, NP_001268671.1
RefSeq Size 659
RefSeq ORF 240
Locus ID 11065
Protein Families Druggable Genome
Protein Pathways Ubiquitin mediated proteolysis
Gene Summary The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, ubiquitin-conjugating enzymes, and ubiquitin-protein ligases. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is required for the destruction of mitotic cyclins and for cell cycle progression, and may be involved in cancer progression. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been defined on chromosomes 4, 14, 15, 18, and 19. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (8) lacks an exon in central coding region, which results in a translational frameshift, compared to variant 1. The encoded isoform (7) has a shorter and distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.