TBCA (NM_001297740) Human Untagged Clone

CAT#: SC333394

TBCA (untagged) - Human tubulin folding cofactor A (TBCA), transcript variant 3


  "NM_001297740" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "TBCA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TBCA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001297740, the custom clone sequence may differ by one or more nucleotides


ATGGCCGATCCTCGCGTGAGACAGATCAAGATCAAGACCGGCGTGGTGAAGCGGTTGGTCAAAGAAAAAG
TGATGTATGAAAAAGAGGCAAAACAACAAGAAGAAAAGATTGAAAAAATGAGAGCTGAAGACGGTGAAAA
TTATGACATTAAAAAGCAGGAAAATGAAAAAGACTTGGAAGAAGCTGAGGAATATAAAGAAGCACGTTTA
GTACTGGATTCAGTGAAGTTAGAAGCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001297740
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001297740.1, NP_001284669.1
RefSeq Size 593 bp
RefSeq ORF 240 bp
Locus ID 6902
Cytogenetics 5q14.1
Gene Summary 'The product of this gene is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. This gene encodes chaperonin cofactor A. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]'
Transcript Variant: This variant (3) has an alternate splice site in the 3' region, which results in alternate translation stop codon, compared to variant 1. The resulting isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.