SCLT1 (NM_001300897) Human Untagged Clone

CAT#: SC333395

SCLT1 (untagged) - Human sodium channel and clathrin linker 1 (SCLT1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SCLT1
• Synonyms: CAP-1A; CAP1A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001300897, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGCAGAAATCGACTTTCTGAGAGAGCAAAATCGAAGACTAAATGAAGATTTTAGGCGGTATCAAA
  TGGAAAGTTTTTCCAAATATTCATCTGTACAGAAAGCTGTCTGCCAAGGAGAAGGAGACGACACATTTGA
  AAACCTAGTATTTGACCAAAGCTTTTTAGCTCCTCTTGTTACTGAGTATGATAAACACCTAGGAGAACTA
  AATGGGCAGCTGAAATATTACCAGGCATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001300897
• ORF Size: 240 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001300897.1, NP_001287826.1
• RefSeq Size: 1793
• RefSeq ORF: 240
• Locus ID: 132320
• Gene Summary: This gene encodes an adaptor protein. Studies of a related gene in rat suggest that the encoded protein functions to link clathrin to the sodium channel protein type 10 subunit alpha protein. The encoded protein has also been identified as a component of distal appendages of centrioles that is necessary for ciliogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (2) lacks several exons and uses an alternate 3'-terminal exon, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1.