CD24 (NM_001291738) Human Untagged Clone

CAT#: SC333400

CD24 (untagged) - Human CD24 molecule (CD24), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD24
• Synonyms: CD24A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001291738, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCAGAGCAATGGTGGCCAGGCTCGGGCTGGGGCTGCTGCTGCTGGCACTGCTCCTACCCACGCAGA
  TTTATTCCAGTGAAACAACAACTGGAACTTCAAGTAACTCCTCCCAGAGTACTTCCAACTCTGGGTTGGC
  CCCAAATCCAACTAATGCCACCACCAAGGCGGCTGGTGGTGCCCTGCAGTCAACAGCCAGTCTCTTCGTG
  GTCTCACTCTCTCTTCTGCATCTCTACTCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291738
• ORF Size: 243 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001291738.1, NP_001278667.1
• RefSeq Size: 2295
• RefSeq ORF: 243
• Locus ID: 100133941
• Gene Summary: This gene encodes a sialoglycoprotein that is expressed on mature granulocytes and B cells and modulates growth and differentiation signals to these cells. The precursor protein is cleaved to a short 32 amino acid mature peptide which is anchored via a glycosyl phosphatidylinositol (GPI) link to the cell surface. This gene was missing from previous genome assemblies, but is properly located on chromosome 6. Non-transcribed pseudogenes have been designated on chromosomes 1, 15, 20, and Y. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
  Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3 and 7 encode isoform a.