PPCDC (NM_001301105) Human Untagged Clone

CAT#: SC333402

PPCDC (untagged) - Human phosphopantothenoylcysteine decarboxylase (PPCDC), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPCDC
• Synonyms: coaC; MDS018; PPC-DC
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001301105, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGGGCCTGGGACCGCAGCAAGCCCCTGCTCTTCTGCCCGGCCATGAACACCGCCATGTGGGAGCACC
  CGATCACAGCGCAGCAGGTAGACCAGCTCAAGGCCTTTGGCTATGTCGAGATCCCCTGTGTGGCCAAGAA
  GCTGGTGTGCGGAGATGAAGGTCTCGGGGCCATGGCTGAAGTGGGGACCATCGTGGACAAAGTGAAAGAA
  GTCCTCTTCCAGCACAGTGGCTTCCAGCAGAGTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301105
• ORF Size: 246 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001301105.1, NP_001288034.1
• RefSeq Size: 2065
• RefSeq ORF: 246
• Locus ID: 60490
• Protein Pathways: Metabolic pathways, Pantothenate and CoA biosynthesis
• Gene Summary: Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCDC (EC 4.1.1.36), one of the last enzymes in this pathway, converts phosphopantothenoylcysteine to 4-prime-phosphopantetheine (Daugherty et al., 2002 [PubMed 11923312]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (6) contains alternate 5' exon structure, and it thus differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (e) is shorter at the N-terminus, compared to isoform a. Both variants 5 and 6 encode isoform e.