PPCDC (NM_001301105) Human Untagged Clone

CAT#: SC333402

PPCDC (untagged) - Human phosphopantothenoylcysteine decarboxylase (PPCDC), transcript variant 6


  "NM_001301105" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "PPCDC"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PPCDC
Synonyms coaC; MDS018; PPC-DC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301105, the custom clone sequence may differ by one or more nucleotides


ATGCGGGCCTGGGACCGCAGCAAGCCCCTGCTCTTCTGCCCGGCCATGAACACCGCCATGTGGGAGCACC
CGATCACAGCGCAGCAGGTAGACCAGCTCAAGGCCTTTGGCTATGTCGAGATCCCCTGTGTGGCCAAGAA
GCTGGTGTGCGGAGATGAAGGTCTCGGGGCCATGGCTGAAGTGGGGACCATCGTGGACAAAGTGAAAGAA
GTCCTCTTCCAGCACAGTGGCTTCCAGCAGAGTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001301105
ORF Size 246 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001301105.1, NP_001288034.1
RefSeq Size 2065
RefSeq ORF 246
Locus ID 60490
Protein Pathways Metabolic pathways, Pantothenate and CoA biosynthesis
Gene Summary Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCDC (EC 4.1.1.36), one of the last enzymes in this pathway, converts phosphopantothenoylcysteine to 4-prime-phosphopantetheine (Daugherty et al., 2002 [PubMed 11923312]). [supplied by OMIM, Mar 2008]
Transcript Variant: This variant (6) contains alternate 5' exon structure, and it thus differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (e) is shorter at the N-terminus, compared to isoform a. Both variants 5 and 6 encode isoform e.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.