Apc10 (ANAPC10) (NM_001256712) Human Untagged Clone

CAT#: SC333409

ANAPC10 (untagged) - Human anaphase promoting complex subunit 10 (ANAPC10), transcript variant 8

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ANAPC10
• Synonyms: APC10; DOC1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256712, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACTACACCAAACAAGACACCTCCTGGTGCTGACCCCAAGCAGTTGGAAAGGACTGGAACAGTACGGG
  AAATTGGGTCACAAGCTGTTTGGTCACTCTCATCTTGCAAACCAGGATTTGGAGTGGATCAGTTACGAGA
  TGACAATCTAGAAACTTATTGGCAATCAGATGGTTCCCAGCCTCATTTAGTGAACATCCAATTCAGCAAC
  TTGAGTTGGTGGAACCAAGTGGCTGGATTCATGTTCCCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256712
• ORF Size: 252 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256712.1, NP_001243641.1
• RefSeq Size: 1336
• RefSeq ORF: 252
• Locus ID: 10393
• Protein Families: Druggable Genome
• Protein Pathways: Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis
• Gene Summary: ANAPC10 is a core subunit of the anaphase-promoting complex (APC), or cyclosome, a ubiquitin protein ligase that is essential for progression through the cell cycle. APC initiates sister chromatid separation by ubiquitinating the anaphase inhibitor securin (PTTG1; MIM 604147) and triggers exit from mitosis by ubiquitinating cyclin B (CCNB1; MIM 123836), the activating subunit of cyclin-dependent kinase-1 (CDK1; MIM 116940) (summary by Wendt et al., 2001 [PubMed 11524682]). [supplied by OMIM, Feb 2011]
  Transcript Variant: This variant (8) uses an alternate splice site in the 5' UTR and lacks an exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (4) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.