Apc11 (ANAPC11) (NM_001289419) Human Untagged Clone
CAT#: SC333440
ANAPC11 (untagged) - Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 13
"NM_001289419" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ANAPC11 |
Synonyms | APC11; Apc11p; HSPC214 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001289419, the custom clone sequence may differ by one or more nucleotides
ATGAGAACTGTGGCATCTGCAGGATGGCATTTAACGGATGCTGCCCTGACTGTGAGTGTCCCCTCCATGC TGTCTGAGCGGCCCCGACTGCAAGGTGCCCGGCGACGACTGCCCGCTGGTGTGGGGCCAGTGCTCCCACT GCTTCCACATGCATTGCATCCTCAAGTGGCTGCACGCACAGCAGGTGCAGCAGCACTGCCCCATGTGCCG CCAGGAATGGAAGTTCAAGGAGTGAGGCCCGACCTGGCTCTCGCTGGAGGGGCATCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289419 |
ORF Size | 270 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001289419.1, NP_001276348.1 |
RefSeq Size | 964 |
RefSeq ORF | 270 |
Locus ID | 51529 |
Protein Families | Druggable Genome |
Protein Pathways | Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis |
Gene Summary | Together with the cullin protein ANAPC2, constitutes the catalytic component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. May recruit the E2 ubiquitin-conjugating enzymes to the complex. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (13) uses an alternate splice site and contains an alternate exon in the 5' UTR, uses an alternate splice site in the 5' coding region, and initiates translation at an alternate downstream start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1. Variants 12 and 13 encode isoform 3. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235546 | ANAPC11 (myc-DDK-tagged) - Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 13 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review