ZNF539 (ZNF254) (NM_001278665) Human Untagged Clone

CAT#: SC333450

ZNF254 (untagged) - Human zinc finger protein 254 (ZNF254), transcript variant 8

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZNF254
• Synonyms: BMZF-5; HD-ZNF1; ZNF91L; ZNF539
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001278665, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCAGGACCCCCTAGAAGCCTAGAAATGGGACTGTTGACATTTAGGGATGTGGCCATAGAATTCTCTC
  TGGAGGAGTGGCAACACCTGGACATTGCACAGCAGAATTTATATAGAAATGTGATGTTAGAGAACTACAG
  AAACCTGGCCTTCCTGGGTATTGCTGTCTCTAAGCCAGACCTGATCACCTGTCTGGAACAAGGGAAAGAG
  CCCTGGAATATGAAGCGACATGAGATGGTGGATGAACCCCCAGGATTGGATTTTTCATTACTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278665
• ORF Size: 276 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001278665.1, NP_001265594.1
• RefSeq Size: 565
• RefSeq ORF: 276
• Locus ID: 9534
• Protein Families: Transcription Factors
• Gene Summary: Zinc finger proteins have been shown to interact with nucleic acids and to have diverse functions. The zinc finger domain is a conserved amino acid sequence motif containing 2 specifically positioned cysteines and 2 histidines that are involved in coordinating zinc. Kruppel-related proteins form 1 family of zinc finger proteins. See ZFP93 (MIM 604749) for additional information on zinc finger proteins. [supplied by OMIM, Jul 2002]
  Transcript Variant: This variant (8) differs in both UTRs and has multiple coding region differences, compared to variant 1. This variant encodes isoform e, which is shorter than isoform a.